Details for gene: APRT


Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]


Symbol
APRT
Name
adenine phosphoribosyltransferase
Entrez ID
353
Ensembl ID
ENSG00000198931    (more details)
KEGG ID
hsa:353    (more details)
OMIM ID
614723
Uniprot ID
P07741  
GO ID
hsa:353    (more details)
Chromosome
16
Strand
-1
Start
88809339
End
88811937
miRNA Interactions
hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-147a (RPM: 0.0014) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-3929 (RPM: 0.0406) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-423-3p (RPM: 1928.5158) /
Involved Diseases
retinoblastoma /
Involved Pathways
Metabolic pathways / Purine metabolism / Immune System / Metabolism / Innate Immune System / Neutrophil degranulation / Metabolism of nucleotides / Purine salvage / Nucleotide salvage /
Sequence
GGCGCGCTCGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCCCCGACTTCCCCACCCCAGGCGTGGTATTCAGGTGCACGCACAGGCCGCCCTCGTGGCGCCCCGACCTGCGGGCCTACGGATGGGAGCGCGTGGCCCGCGACCTCCGGGCGGGCGGGGCGGGAACCCTCGTCTTTCGCCCCCGGGGCCCTGCCCTCCTTCGGCCCCGGCGTCACCAGGCCTGTCCTTGGGTCCAGGGACATCTCGCCCGTCCTGAAGGACCCCGCCTCCTTCCGCGCCGCCATCGGCCTCCTGGCGCGACACCTGAAGGCGACCCACGGGGGCCGCATCGACTACATCGCAGGCGAGTGCCCAGTGGCCGCATCTAGGGCGCTTCCGCCTCTGCGCGCGCCGAGGGCAGCACGTGGGCTCTGCGCGTCTGCTTGGGGGAGGGCCTTTGGGGTGCTTCAGGGGGCGCCGGGACGGGCGCCGTGCTTGGGTCGCCCGGGAAGGGTTGTGAGATTGAGCCCCCGAGGCCGCCGCGCTGTGCAGGCGTCCTTCCCGCAGGTTCCGGGTCCCCAGCCCAGGACAGGCGTGACCGAGTTGCCGGGTCAGTTGGTCTCCCTGGAGTGCCCAAGCTGAATCCACAGGGCCCAGCTGCCTTGCTTCTTGTTCCTTCTGCGAGCTGGTATTGAGCGCCTGCCACGAGCCAGGCCTTCCCTGGTGAAGATCACGGAATGCCCACCCAGGGAAGGGAGGCCTGGAGGCCTCCGGGAGAGCCCAAGAGGTGGCCCAGGGAGAACAGAGTGTTCCTGGCCGTCTTGCCTCTCCTAGGGTGTGACAGCCCACTCCCTGGACACTGCCCTGAGGAAAGCGCCAGCTCTTGCTGGAGCCACAACACTGCCAGAGCTCCCTTCTCACCTCCTGCAGGAAGCCCTCCCTGACCTCCTGCCAGGCCGGGGCAGGGTTTCCCTGAGCGTCCCCCAACCATCACAGCTCAGGCCACCTCGAGAGACTCCCTTTTTAGACAGAAGCCCTGGTGCAGAGCTGCCTTTGAGAGTAAGCTGAGGCCTGTCAGGTTTCTACCAGCCCAGTTACAGATGGGCTGCTCAGCTCAGAGAGAGGGGTGGTGACTCCCCTAGGAACACACAGCTAAGAAGTGGTCCCTTAAAAGACAGACCCAGGTCTGCACTCTGACCTGGAAGCAGCTCCGGGTAGGTGATGGGTAACATTCCTTAAATGGTGCATGTCACTGGCCTTTCAGCTGGGAGCCAACCAGGTACCCCTTGCCACCGGCCAACCCTGGCCCCTGGGGATTCCCATGCTGCCGAGTCACTCCTGTCACTTACCCTGACAGGCCTAGACTCCCGAGGCTTCCTCTTTGGCCCCTCCCTGGCCCAGGAGCTTGGACTGGGCTGCGTGCTCATCCGAAAGCGGGGGAAGCTGCCAGGCCCCACTCTGTGGGCCTCCTATTCCCTGGAGTACGGGAAGGTAAGAGGGCTGGGGTGGCCAGAGGAAGGGCAGGGCCAGGCCACCGTGGCCACTCTCCCCCAGTTCTAAAAGGCCTTCCCAGGCGTGTCAAGTGGAGCTGCTGTGGTTACAGTGGCCTTGGGAGCTCAGAGAGGTTGAGACATAGGCTGGGCTCACACAGCCAGGTAACAGCAAGGTGGGGTTGGAGTCAGGGTCTAGGGTGGCAGCTGCCAAGCTGTGCAACAAAGCTGTTTTCTGCGGGAGGCTGAGGACCACACACCACTTCCCACTCCAGGCTGAGCTGGAGATTCAGAAAGACGCCCTGGAGCCAGGACAGAGGGTGGTCGTCGTGGATGATCTGCTGGCCACTGGTGGTAAGGGTCTCCCCGCAGCCAACTGCTGTGGCTCCAAGGGCCTGGTGGGAGTGGGACAGGACCTCGCTGTGTGACATGGGATGCAGCTTACTGTTGTCCAGAGGGTGCCTGGTGGCCAGGCCGACACCTTCCTCTCCCCATGCCTTCCCCTCCCCAACCCAGGGGCTGGCCTGGAGCACCTGCTCTCTGCAGCCCAGGCCAACTGGGGACCTCACCCTCCCATCCCCAGGAACCATGAACGCTGCCTGTGAGCTGCTGGGCCGCCTGCAGGCTGAGGTCCTGGAGTGCGTGAGCCTGGTGGAGCTGACCTCGCTTAAGGGCAGGGAGAAGCTGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAGCCACACTGAACCCAATTACACACAGCGGGAGAACGCAGTAAACAGCTTTCCCACAAGAGCCGTCTCCTGTCCTCCTGTTCCCCAGGGCAGGGAGCCCCAGGACAACACCAGACTTCAGCTGTACTGTGGGCATGTGCTGCTTGGCGTGATGCCCAGCAGAACCTGTCCTGGTTCTCACCTCAGGAG

Back to List