Details for gene: CAPN5


Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid.


Symbol
CAPN5
Name
calpain 5
Entrez ID
726
Ensembl ID
ENSG00000149260    (more details)
KEGG ID
hsa:726    (more details)
OMIM ID
602537
Uniprot ID
O15484  
GO ID
hsa:726    (more details)
Chromosome
11
Strand
1
Start
77066961
End
77126155
miRNA Interactions
hsa-miR-1277-5p (RPM: 3.0234) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-1285-3p (RPM: 7.2094) / hsa-miR-5189-5p (RPM: 0.665) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-612 (RPM: 0.0216) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-2467-3p (RPM: 0.0206) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-873-5p (RPM: 18.2502) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4448 (RPM: 1.2208) / hsa-miR-376c-3p (RPM: 10.6544) / hsa-miR-5702 (RPM: 0.0032) / hsa-miR-3187-5p (RPM: 0.0504) / hsa-miR-3667-3p (RPM: 0.0008) / hsa-miR-941 (RPM: 399.631) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-190a-3p (RPM: 0.756) / hsa-miR-6721-5p (RPM: 0.2712) / hsa-miR-6720-5p (RPM: 0.0746) / hsa-miR-6860 (RPM: 0.0058) / hsa-miR-6734-3p (RPM: 0.014) / hsa-miR-6772-3p (RPM: 1.3658) / hsa-miR-6847-5p (RPM: 0.6722) / hsa-miR-383-3p (RPM: 0.0168) /
Involved Diseases
proliferative vitreoretinopathy (PVR) /
Involved Pathways
Degradation of the extracellular matrix /
Sequence
ATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGCGCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGGCACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTTGTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAGCCTGCTCGTCACTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCAGGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACTTCCACTTCTGGCGCTTCGGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACTGCCACTCCAACTCCCGCAATGAGTTTTGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGCAGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTTCACGGGTGGTGTTTCTGAGCCCATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGACTAAGAGGAACCAGCTCTTTGAGCGCATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGTGACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTCACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAGTCAGAGAAGTTGGACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTCGGAGGAGTGGCAGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCAGGACGACGGTGAGTTCTGGATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCGTGATCAACACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTGGACGCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTTCTTCCAGAACCCACAGTACATCTTCGAAGTCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCCAGCAGCGGCCAAAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCATTGGCTTTGACATCTACAAGGTGGAGGAGAACCGCCAGTACCGCATGCACAGCCTGCAGCACAAGGCCGCCAGCTCCATCTACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCAGCCCGAGGGCCGCTATGTCATCATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCTGCTCCGAGTCTTCACTGATGTGCCCTCCAACTGCCGGGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGTGGCTACCCCCAGCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAACAGGGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGCTCGGCTGTGCAGAAGGGCACCTCCACACCAGAGTACAATGTGAAAGGCATCTTCTACCGCAAGAAGCTGAGCCAGCCCATCACTGTACAGGTCTGGAACCACCGAGTGCTGAAGGATGAATTTCTGGGCCAGGTGCACCTAAAGGCTGACCCGGACAACCTCCAGGCCCTGCATACCCTCCACCTCCGGGACCGAAATAGCCGGCAGCCCAGCAACCTGCCAGGCACTGTGGCCGTGCACATTCTCAGCAGCACCTCCCTCATGGCTGTCTGA

Back to List