Details for gene: HLA-DRB1


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
HLA-DRB1
Name
major histocompatibility complex, class II, DR beta 1
Entrez ID
3123
Ensembl ID
ENSG00000196126    (more details)
KEGG ID
hsa:3123    (more details)
OMIM ID
142857
Uniprot ID
P01911  
GO ID
hsa:3123    (more details)
Chromosome
6
Strand
-1
Start
32578769
End
32589848
miRNA Interactions
hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-5006-3p (RPM: 0.4468) / hsa-miR-579-3p (RPM: 0.0084) / hsa-miR-664b-3p (RPM: 4.7274) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-5696 (RPM: 0.3778) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-4755-5p (RPM: 0.0232) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-502-5p (RPM: 0.9904) / hsa-miR-141-5p (RPM: 20.664) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-1306-5p (RPM: 5.6804) / hsa-miR-6875-3p (RPM: 0.0698) / hsa-miR-153-5p (RPM: 0.2042) / hsa-miR-627-3p (RPM: 0.3504) / hsa-miR-6832-3p (RPM: 0.003) /
Involved Diseases
primary Sjögren's syndrome (pSS) / Vogt-Koyanagi-Harada disease /
Involved Pathways
Inflammatory bowel disease (IBD) / Epstein-Barr virus infection / HTLV-I infection / Rheumatoid arthritis / Cytokine-cytokine receptor interaction / Hematopoietic cell lineage / Toxoplasmosis / Tuberculosis / Influenza A / Herpes simplex infection / Viral myocarditis / Type I diabetes mellitus / Cell adhesion molecules (CAMs) / Staphylococcus aureus infection / Phagosome / Leishmaniasis / Antigen processing and presentation / Asthma / Systemic lupus erythematosus / Allograft rejection / Graft-versus-host disease / Chemokine signaling pathway / Autoimmune thyroid disease / Interferon gamma signaling / Downstream TCR signaling / Phosphorylation of CD3 and TCR zeta chains / Translocation of ZAP-70 to Immunological synapse / Generation of second messenger molecules / MHC class II antigen presentation / PD-1 signaling / Th17 cell differentiation / Intestinal immune network for IgA production / Th1 and Th2 cell differentiation /
Sequence
ATGGTGTGTCTGAGGCTCCCTGGAGGCTCCTGCATGGCAGTTCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCAGACCACGTTTCTTGGAGTACTCTACGTCTGAGTGTCATTTCTTCAATGGGACGGAGCGGGTGCGGTACCTGGACAGATACTTCCATAACCAGGAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACAGCCAGAAGGACCTCCTGGAGCAGAAGCGGGGCCGGGTGGACAACTACTGCAGACACAACTACGGGGTTGTGGAGAGCTTCACAGTGCAGCGGCGAGTCCATCCTAAGGTGACTGTGTATCCTTCAAAGACCCAGCCCCTGCAGCACCATAACCTCCTGGTCTGTTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATGGCCAGGAAGAGAAGACTGGGGTGGTGTCCACAGGCCTGATCCACAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACAAGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAGCCAAGAGGATTCCTGAGCTGA

Back to List