Details for gene: IRF5


Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II.


Symbol
IRF5
Name
interferon regulatory factor 5
Entrez ID
3663
Ensembl ID
ENSG00000128604    (more details)
KEGG ID
hsa:3663    (more details)
OMIM ID
607218
Uniprot ID
Q13568  
GO ID
hsa:3663    (more details)
Chromosome
7
Strand
1
Start
128937457
End
128950038
miRNA Interactions
hsa-miR-4705 (RPM: 0.444) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-1275 (RPM: 5.7258) /
Involved Diseases
primary Sjögren's syndrome (pSS) /
Involved Pathways
Toll-like receptor signaling pathway / Interferon gamma signaling / Interferon alpha/beta signaling /
Sequence
ATGAACCAGTCCATCCCAGTGGCTCCCACCCCACCCCGCCGCGTGCGGCTGAAGCCCTGGCTGGTGGCCCAGGTGAACAGCTGCCAGTACCCAGGGCTTCAATGGGTCAACGGGGAAAAGAAATTATTCTGCATCCCCTGGAGGCATGCCACAAGGCATGGTCCCAGCCAGGACGGAGATAACACCATCTTCAAGGCCTGGGCCAAGGAGACAGGGAAATACACCGAAGGCGTGGATGAAGCCGATCCGGCCAAGTGGAAGGCCAACCTGCGCTGTGCCCTTAACAAGAGCCGGGACTTCCGCCTCATCTACGACGGGCCCCGGGACATGCCACCTCAGCCCTACAAGATCTACGAGGTCTGCTCCAATGGCCCTGCTCCCACAGACTCCCAGCCCCCTGAGGATTACTCTTTTGGTGCAGGAGAGGAGGAGGAAGAAGAGGAAGAGCTGCAGAGGATGTTGCCAAGCCTGAGCCTCACAGAGGATGTCAAGTGGCCGCCCACTCTGCAGCCGCCCACTCTGCGGCCGCCTACTCTGCAGCCGCCCACTCTGCAGCCGCCCGTGGTGCTGGGTCCCCCTGCTCCAGACCCCAGCCCCCTGGCTCCTCCCCCTGGCAACCCTGCTGGCTTCAGGGAGCTTCTCTCTGAGGTCCTGGAGCCTGGGCCCCTGCCTGCCAGCCTGCCCCCTGCAGGCGAACAGCTCCTGCCAGACCTGCTGATCAGCCCCCACATGCTGCCTCTGACCGACCTGGAGATCAAGTTTCAGTACCGGGGGCGGCCACCCCGGGCCCTCACCATCAGCAACCCCCATGGCTGCCGGCTCTTCTACAGCCAGCTGGAGGCCACCCAGGAGCAGGTGGAACTCTTCGGCCCCATAAGCCTGGAGCAAGTGCGCTTCCCCAGCCCTGAGGACATCCCCAGTGACAAGCAGCGCTTCTACACGAACCAGCTGCTGGATGTCCTGGACCGCGGGCTCATCCTCCAGCTACAGGGCCAGGACCTTTATGCCATCCGCCTGTGTCAGTGCAAGGTGTTCTGGAGCGGGCCTTGTGCCTCAGCCCATGACTCATGCCCCAACCCCATCCAGCGGGAGGTCAAGACCAAGCTTTTCAGCCTGGAGCATTTTCTCAATGAGCTCATCCTGTTCCAAAAGGGCCAGACCAACACCCCACCACCCTTCGAGATCTTCTTCTGCTTTGGGGAAGAATGGCCTGACCGCAAACCCCGAGAGAAGAAGCTCATTACTGTACAGGTGGTGCCTGTAGCAGCTCGACTGCTGCTGGAGATGTTCTCAGGGGAGCTATCTTGGTCAGCTGATAGTATCCGGCTACAGATCTCAAACCCAGACCTCAAAGACCGCATGGTGGAGCAATTCAAGGAGCTCCATCACATCTGGCAGTCCCAGCAGCGGTTGCAGCCTGTGGCCCAGGCCCCTCCTGGAGCAGGCCTTGGTGTTGGCCAGGGGCCCTGGCCTATGCACCCAGCTGGCATGCAATAA

Back to List