Details for gene: GJA8


Any process that mediates interactions between a cell and its surroundings. Encompasses interactions such as signaling or attachment between one cell and another cell, between a cell and an extracellular matrix, or between a cell and any other aspect of its environment.


Symbol
GJA8
Name
gap junction protein alpha 8
Entrez ID
2703
Ensembl ID
ENSG00000121634    (more details)
KEGG ID
hsa:2703    (more details)
OMIM ID
600897
Uniprot ID
P48165  
GO ID
hsa:2703    (more details)
Chromosome
1
Strand
1
Start
147902795
End
147909269
miRNA Interactions
hsa-miR-182-5p (RPM: 77446.6216) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-941 (RPM: 399.631) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Gap junction trafficking and regulation / Gap junction trafficking / Gap junction assembly / Membrane Trafficking / Vesicle-mediated transport / Translocation of SLC2A4 (GLUT4) to the plasma membrane / Kinesins / MHC class II antigen presentation / Intraflagellar transport /
Sequence
ATGGGCGACTGGAGTTTCCTGGGGAACATCTTGGAGGAGGTGAATGAGCACTCCACCGTCATCGGCAGAGTCTGGCTCACCGTGCTTTTCATCTTCCGGATCCTCATCCTTGGCACGGCCGCAGAGTTCGTGTGGGGGGATGAGCAATCCGACTTCGTGTGCAACACCCAGCAGCCTGGCTGCGAGAACGTCTGCTACGACGAGGCCTTTCCCATCTCCCACATTCGCCTCTGGGTGCTGCAGATCATCTTCGTCTCCACCCCGTCCCTGATGTACGTGGGGCACGCGGTGCACTACGTCCGCATGGAGGAGAAGCGCAAAAGCCGCGAGGCGGAGGAGCTGGGCCAGCAGGCGGGGACTAACGGCGGCCCGGACCAGGGCAGCGTCAAGAAGAGCAGCGGCAGCAAAGGCACTAAGAAGTTCCGGCTGGAGGGGACCCTGCTGAGGACCTACATCTGCCACATCATCTTCAAGACCCTCTTTGAAGTGGGCTTCATCGTGGGCCACTACTTCCTGTACGGGTTCCGGATCCTGCCTCTGTACCGCTGCAGCCGGTGGCCCTGCCCCAATGTGGTGGACTGCTTCGTGTCCCGGCCCACGGAGAAAACCATCTTCATCCTGTTCATGTTGTCTGTGGCCTCTGTGTCCCTATTCCTCAACGTGATGGAGTTGGGCCACCTGGGCCTGAAGGGGATCCGGTCTGCCTTGAAGAGGCCTGTAGAGCAGCCCCTGGGGGAGATTCCTGAGAAATCCCTCCACTCCATTGCTGTCTCCTCCATCCAGAAAGCCAAGGGCTATCAGCTCCTAGAAGAAGAGAAAATCGTTTCCCACTATTTCCCCTTGACCGAGGTTGGGATGGTGGAGACCAGCCCACTGCCTGCCAAGCCTTTCAATCAGTTCGAGGAGAAGATCAGCACAGGACCCCTGGGGGACTTGTCCCGGGGCTACCAAGAGACACTGCCTTCCTACGCTCAGGTGGGGGCACAAGAAGTGGAGGGCGAGGGGCCGCCTGCAGAGGAGGGAGCCGAACCCGAGGTGGGAGAGAAGAAGGAGGAAGCAGAGAGGCTGACCACGGAGGAGCAGGAGAAGGTGGCCGTGCCAGAGGGGGAGAAAGTAGAGACCCCCGGAGTGGATAAGGAGGGTGAAAAAGAAGAGCCGCAGTCGGAGAAGGTGTCAAAGCAAGGGCTGCCAGCTGAGAAGACACCTTCACTCTGTCCAGAGCTGACAACAGATGATGCCAGACCCCTGAGCAGGCTAAGCAAAGCCAGCAGCCGAGCCAGGTCAGACGATCTAACCGTATGA

Back to List