Details for gene: CRYBB2


The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image.


Symbol
CRYBB2
Name
crystallin beta B2
Entrez ID
1415
Ensembl ID
ENSG00000244752    (more details)
KEGG ID
hsa:1415    (more details)
OMIM ID
123620
Uniprot ID
P43320  
GO ID
hsa:1415    (more details)
Chromosome
22
Strand
1
Start
25212564
End
25231870
miRNA Interactions
hsa-miR-129-2-3p (RPM: 79.8688) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGCCTCAGATCACCAGACCCAGGCGGGCAAGCCACAGTCCCTCAACCCCAAGATCATCATCTTTGAGCAGGAAAACTTTCAAGGCCACTCGCATGAGCTCAATGGGCCCTGCCCCAACCTGAAGGAAACTGGCGTGGAGAAGGCAGGTTCTGTCCTAGTGCAGGCTGGACCCTGGGTGGGCTATGAACAGGCCAACTGCAAGGGCGAGCAGTTTGTGTTTGAGAAGGGTGAGTACCCCCGCTGGGACTCATGGACCAGCAGCCGAAGGACGGACTCCCTCAGCTCCCTGAGGCCCATCAAAGTGGACAGCCAAGAGCACAAGATCATCCTCTATGAAAACCCCAACTTCACCGGGAAGAAGATGGAAATCATAGATGACGATGTACCCAGCTTCCACGCCCATGGCTACCAGGAGAAGGTGTCATCTGTGCGGGTGCAGAGTGGCACGTGGGTTGGCTACCAGTACCCCGGCTACCGTGGGCTGCAGTACCTGCTGGAGAAGGGAGACTACAAGGACAGCAGCGACTTTGGGGCCCCTCACCCCCAGGTGCAGTCCGTGCGCCGTATCCGCGACATGCAGTGGCACCAACGTGGTGCCTTCCACCCCTCCAACTAG

Back to List