Details for gene: CRYGD


A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.


Symbol
CRYGD
Name
crystallin gamma D
Entrez ID
1421
Ensembl ID
ENSG00000118231    (more details)
KEGG ID
hsa:1421    (more details)
OMIM ID
123690
Uniprot ID
P07320  
GO ID
hsa:1421    (more details)
Chromosome
2
Strand
-1
Start
208121607
End
208124524
miRNA Interactions
hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGGGAAGATCACCCTCTACGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGCAGCGACCACCCCAACCTGCAGCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGCGGCTGCTGGATGCTCTATGAGCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGCGGCGACTATGCCGACCACCAGCAGTGGATGGGCCTCAGCGACTCGGTCCGCTCCTGCCGCCTCATCCCCCACTCTGGCTCTCACAGGATCAGACTCTATGAGAGAGAGGACTACAGAGGCCAGATGATAGAGTTCACTGAGGACTGCTCCTGTCTTCAGGACCGCTTCCGCTTCAATGAAATCCACTCCCTCAACGTGCTGGAGGGCTCCTGGGTCCTCTACGAGCTGTCCAACTACCGAGGACGGCAGTACCTGCTGATGCCAGGGGACTATAGGCGCTACCAGGACTGGGGGGCCACGAATGCCAGAGTGGGCTCTCTGAGGAGAGTCATAGATTTCTCCTGA

Back to List