Details for gene: EPHA2


The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane.


Symbol
EPHA2
Name
EPH receptor A2
Entrez ID
1969
Ensembl ID
ENSG00000142627    (more details)
KEGG ID
hsa:1969    (more details)
OMIM ID
176946
Uniprot ID
P29317  
GO ID
hsa:1969    (more details)
Chromosome
1
Strand
-1
Start
16124337
End
16156069
miRNA Interactions
hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-3187-3p (RPM: 1.1952) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-1286 (RPM: 0.3108) / hsa-miR-3133 (RPM: 0.0266) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-3675-5p (RPM: 0.1374) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-588 (RPM: 0.0032) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-520d-3p (RPM: 0.0042) / hsa-miR-5000-3p (RPM: 4.2358) / hsa-miR-548s (RPM: 0.1718) / hsa-miR-1197 (RPM: 2.7672) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-4712-3p (RPM: 0.0536) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-3605-5p (RPM: 7.5582) / hsa-miR-3679-5p (RPM: 0.274) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-486-3p (RPM: 65.2834) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-5187-5p (RPM: 0.1354) / hsa-miR-940 (RPM: 4.614) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-4744 (RPM: 0.0012) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-4435 (RPM: 1.1176) / hsa-miR-4701-5p (RPM: 0.05) / hsa-miR-4526 (RPM: 0.1442) / hsa-miR-675-5p (RPM: 0.6068) / hsa-miR-1185-5p (RPM: 4.6416) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-211-3p (RPM: 66.2628) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-1255b-5p (RPM: 0.0196) / hsa-miR-3622b-5p (RPM: 0.0704) / hsa-miR-888-3p (RPM: 0.0024) / hsa-miR-1255a (RPM: 0.3384) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-122-3p (RPM: 0.003) / hsa-miR-6721-5p (RPM: 0.2712) / hsa-miR-605-3p (RPM: 0.1834) / hsa-miR-6862-5p (RPM: 0.29) / hsa-miR-6757-5p (RPM: 0.0978) / hsa-miR-6754-5p (RPM: 0.0514) / hsa-miR-6877-5p (RPM: 0.209) / hsa-miR-2392 (RPM: 0.0324) / hsa-miR-128-1-5p (RPM: 12.1924) / hsa-miR-128-2-5p (RPM: 0.1962) / hsa-miR-6762-5p (RPM: 0.0064) / hsa-miR-6845-5p (RPM: 0.4416) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
MAPK signaling pathway / Ras signaling pathway / Rap1 signaling pathway / PI3K-Akt signaling pathway / Axon guidance / Developmental Biology / EPH-Ephrin signaling / EPHA-mediated growth cone collapse / EPH-ephrin mediated repulsion of cells / Axon guidance / Nervous system development / RAC1 GTPase cycle / RAC2 GTPase cycle / RHOG GTPase cycle / RHOU GTPase cycle / RAC3 GTPase cycle / RHOV GTPase cycle / RND3 GTPase cycle / RND2 GTPase cycle / RND1 GTPase cycle /
Sequence
ATGGAGCTCCAGGCAGCCCGCGCCTGCTTCGCCCTGCTGTGGGGCTGTGCGCTGGCCGCGGCCGCGGCGGCGCAGGGCAAGGAAGTGGTACTGCTGGACTTTGCTGCAGCTGGAGGGGAGCTCGGCTGGCTCACACACCCGTATGGCAAAGGGTGGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCTGTGTGGCGCTGCTCTCCGTCCGTGTCTACTACAAGAAGTGCCCCGAGCTGCTGCAGGGCCTGGCCCACTTCCCTGAGACCATCGCCGGCTCTGATGCACCTTCCCTGGCCACTGTGGCCGGCACCTGTGTGGACCATGCCGTGGTGCCACCGGGGGGTGAAGAGCCCCGTATGCACTGTGCAGTGGATGGCGAGTGGCTGGTGCCCATTGGGCAGTGCCTGTGCCAGGCAGGCTACGAGAAGGTGGAGGATGCCTGCCAGGCCTGCTCGCCTGGATTTTTTAAGTTTGAGGCATCTGAGAGCCCCTGCTTGGAGTGCCCTGAGCACACGCTGCCATCCCCTGAGGGTGCCACCTCCTGCGAGTGTGAGGAAGGCTTCTTCCGGGCACCTCAGGACCCAGCGTCGATGCCTTGCACACGACCCCCCTCCGCCCCACACTACCTCACAGCCGTGGGCATGGGTGCCAAGGTGGAGCTGCGCTGGACGCCCCCTCAGGACAGCGGGGGCCGCGAGGACATTGTCTACAGCGTCACCTGCGAACAGTGCTGGCCCGAGTCTGGGGAATGCGGGCCGTGTGAGGCCAGTGTGCGCTACTCGGAGCCTCCTCACGGACTGACCCGCACCAGTGTGACAGTGAGCGACCTGGAGCCCCACATGAACTACACCTTCACCGTGGAGGCCCGCAATGGCGTCTCAGGCCTGGTAACCAGCCGCAGCTTCCGTACTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTGCGCCGCACCGAGGGTTTCTCCGTGACCCTGGACGACCTGGCCCCAGACACCACCTACCTGGTCCAGGTGCAGGCACTGACGCAGGAGGGCCAGGGGGCCGGCAGCAAGGTGCACGAATTCCAGACGCTGTCCCCGGAGGGATCTGGCAACTTGGCGGTGATTGGCGGCGTGGCTGTCGGTGTGGTCCTGCTTCTGGTGCTGGCAGGAGTTGGCTTCTTTATCCACCGCAGGAGGAAGAACCAGCGTGCCCGCCAGTCCCCGGAGGACGTTTACTTCTCCAAGTCAGAACAACTGAAGCCCCTGAAGACATACGTGGACCCCCACACATATGAGGACCCCAACCAGGCTGTGTTGAAGTTCACTACCGAGATCCATCCATCCTGTGTCACTCGGCAGAAGGTGATCGGAGCAGGAGAGTTTGGGGAGGTGTACAAGGGCATGCTGAAGACATCCTCGGGGAAGAAGGAGGTGCCGGTGGCCATCAAGACGCTGAAAGCCGGCTACACAGAGAAGCAGCGAGTGGACTTCCTCGGCGAGGCCGGCATCATGGGCCAGTTCAGCCACCACAACATCATCCGCCTAGAGGGCGTCATCTCCAAATACAAGCCCATGATGATCATCACTGAGTACATGGAGAATGGGGCCCTGGACAAGTTCCTTCGGGAGAAGGATGGCGAGTTCAGCGTGCTGCAGCTGGTGGGCATGCTGCGGGGCATCGCAGCTGGCATGAAGTACCTGGCCAACATGAACTATGTGCACCGTGACCTGGCTGCCCGCAACATCCTCGTCAACAGCAACCTGGTCTGCAAGGTGTCTGACTTTGGCCTGTCCCGCGTGCTGGAGGACGACCCCGAGGCCACCTACACCACCAGTGGCGGCAAGATCCCCATCCGCTGGACCGCCCCGGAGGCCATTTCCTACCGGAAGTTCACCTCTGCCAGCGACGTGTGGAGCTTTGGCATTGTCATGTGGGAGGTGATGACCTATGGCGAGCGGCCCTACTGGGAGTTGTCCAACCACGAGGTGATGAAAGCCATCAATGATGGCTTCCGGCTCCCCACACCCATGGACTGCCCCTCCGCCATCTACCAGCTCATGATGCAGTGCTGGCAGCAGGAGCGTGCCCGCCGCCCCAAGTTCGCTGACATCGTCAGCATCCTGGACAAGCTCATTCGTGCCCCTGACTCCCTCAAGACCCTGGCTGACTTTGACCCCCGCGTGTCTATCCGGCTCCCCAGCACGAGCGGCTCGGAGGGGGTGCCCTTCCGCACGGTGTCCGAGTGGCTGGAGTCCATCAAGATGCAGCAGTATACGGAGCACTTCATGGCGGCCGGCTACACTGCCATCGAGAAGGTGGTGCAGATGACCAACGACGACATCAAGAGGATTGGGGTGCGGCTGCCCGGCCACCAGAAGCGCATCGCCTACAGCCTGCTGGGACTCAAGGACCAGGTGAACACTGTGGGGATCCCCATCTGA

Back to List