Details for gene: CRYAA


The action of a molecule that contributes to the structural integrity of the lens of an eye.


Symbol
CRYAA
Name
crystallin alpha A
Entrez ID
1409
Ensembl ID
ENSG00000160202    (more details)
KEGG ID
hsa:1409    (more details)
OMIM ID
123580
Uniprot ID
P02489  
GO ID
hsa:1409    (more details)
Chromosome
21
Strand
1
Start
43169008
End
43172805
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-185-3p (RPM: 4.0636) / hsa-miR-3929 (RPM: 0.0406) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-483-3p (RPM: 2.3898) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
PI3K-Akt signaling pathway / Protein processing in endoplasmic reticulum / Focal adhesion / ECM-receptor interaction / Protein digestion and absorption / Pathways in cancer / Amoebiasis / Small cell lung cancer /
Sequence
ATGGACGTGACCATCCAGCACCCCTGGTTCAAGCGCACCCTGGGGCCCTTCTACCCCAGCCGGCTGTTCGACCAGTTTTTCGGCGAGGGCCTTTTTGAGTATGACCTGCTGCCCTTCCTGTCGTCCACCATCAGCCCCTACTACCGCCAGTCCCTCTTCCGCACCGTGCTGGACTCCGGCATCTCTGAGGTTCGATCCGACCGGGACAAGTTCGTCATCTTCCTCGATGTGAAGCACTTCTCCCCGGAGGACCTCACCGTGAAGGTGCAGGACGACTTTGTGGAGATCCACGGAAAGCACAACGAGCGCCAGGACGACCACGGCTACATTTCCCGTGAGTTCCACCGCCGCTACCGCCTGCCGTCCAACGTGGACCAGTCGGCCCTCTCTTGCTCCCTGTCTGCCGATGGCATGCTGACCTTCTGTGGCCCCAAGATCCAGACTGGCCTGGATGCCACCCACGCCGAGCGAGCCATCCCCGTGTCGCGGGAGGAGAAGCCCACCTCGGCTCCCTCGTCCTAA

Back to List