Details for gene: PITX3


Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).


Symbol
PITX3
Name
paired like homeodomain 3
Entrez ID
5309
Ensembl ID
ENSG00000107859    (more details)
KEGG ID
hsa:5309    (more details)
OMIM ID
602669
Uniprot ID
O75364  
GO ID
hsa:5309    (more details)
Chromosome
10
Strand
-1
Start
102230186
End
102241512
miRNA Interactions
hsa-miR-133b (RPM: 3.2122) / hsa-miR-3662 (RPM: 0.0344) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3180 (RPM: 0.436) / hsa-miR-4676-5p (RPM: 0.0286) / hsa-miR-3180-3p (RPM: 0.436) / hsa-miR-3196 (RPM: 0.7584) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGAGTTCGGCCTGCTCAGCGAGGCAGAGGCCCGGAGCCCTGCCCTGTCGCTGTCAGACGCTGGCACTCCGCACCCCCAGCTCCCAGAGCACGGCTGCAAGGGCCAGGAGCACAGCGACTCAGAAAAGGCCTCGGCTTCGCTGCCCGGCGGCTCCCCAGAGGACGGTTCGCTGAAAAAGAAGCAGCGGCGGCAGCGCACGCACTTCACCAGCCAGCAGCTACAGGAGCTAGAGGCGACCTTCCAGAGGAACCGCTACCCCGACATGAGCACGCGCGAGGAGATCGCCGTGTGGACCAACCTCACCGAGGCCCGCGTGCGGGTGTGGTTCAAGAACCGGCGCGCCAAATGGCGGAAGCGCGAGCGCAGCCAGCAGGCCGAGCTATGCAAAGGCAGCTTCGCGGCGCCGCTCGGGGGGCTGGTGCCGCCCTACGAGGAGGTGTACCCCGGCTACTCGTACGGCAACTGGCCGCCCAAGGCTCTTGCCCCGCCGCTCGCCGCCAAGACCTTTCCATTCGCCTTCAACTCGGTCAACGTGGGGCCTCTGGCTTCGCAGCCCGTCTTCTCGCCACCCAGCTCCATCGCCGCCTCCATGGTGCCCTCCGCCGCGGCTGCCCCGGGCACCGTGCCAGGGCCTGGGGCCCTGCAGGGCCTGGGCGGGGGCCCCCCCGGGCTGGCTCCGGCCGCCGTGTCCTCCGGGGCCGTGTCCTGCCCTTATGCCTCGGCCGCCGCCGCCGCCGCGGCTGCCGCCTCTTCCCCCTACGTCTATCGGGACCCGTGTAACTCGAGCCTGGCCAGCCTGCGGCTCAAAGCCAAACAGCACGCCTCCTTCAGCTACCCCGCTGTGCACGGGCCGCCCCCGGCAGCCAACCTTAGTCCGTGCCAGTACGCCGTGGAAAGGCCCGTATGA

Back to List