Details for gene: BFSP2


The action of a molecule that contributes to the structural integrity of a complex or its assembly within or outside a cell.


Symbol
BFSP2
Name
beaded filament structural protein 2
Entrez ID
8419
Ensembl ID
ENSG00000170819    (more details)
KEGG ID
hsa:8419    (more details)
OMIM ID
603212
Uniprot ID
Q13515  
GO ID
hsa:8419    (more details)
Chromosome
3
Strand
1
Start
133400056
End
133475222
miRNA Interactions
hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-941 (RPM: 399.631) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGAGTGAGAGGCGAGTGGTAGTGGACTTGCCCACCAGTGCCAGCTCCAGCATGCCCCTCCAGAGGCGCAGGGCGTCCTTCAGGGGGCCACGGTCATCATCCTCCCTGGAGAGCCCCCCAGCCTCCAGGACCAATGCCATGAGTGGCCTTGTCCGAGCACCCGGGGTCTATGTAGGAACAGCACCCAGTGGGTGCATAGGTGGCTTGGGTGCCCGTGTGACCCGCCGGGCCCTCGGCATCAGCAGTGTCTTCCTTCAGGGCCTGCGGAGCTCAGGCCTGGCCACCGTGCCGGCTCCAGGTTTGGAGAGGGACCATGGTGCTGTTGAGGACCTAGGGGGCTGCCTGGTGGAATATATGGCCAAAGTGCACGCCCTTGAGCAAGTCAGTCAGGAGCTGGAAACACAACTGCGGATGCACCTGGAGAGCAAAGCCACACGCTCGGGAAACTGGGGTGCCCTACGGGCTTCCTGGGCCAGCAGCTGCCAGCAGGTGGGTGAGGCAGTCTTGGAAAATGCCCGGCTCATGCTGCAGACAGAAACTATCCAGGCCGGAGCAGATGACTTTAAAGAGAGATATGAAAATGAGCAGCCATTTCGAAAGGCGGCAGAAGAGGAAATTAACTCTCTGTATAAAGTCATTGATGAGGCTAATTTGACTAAAATGGACCTGGAGAGTCAAATAGAAAGTCTGAAAGAAGAACTTGGCTCTCTATCAAGAAACTATGAAGAGGATGTGAAGCTGCTGCACAAACAGTTGGCAGGGTGTGAGCTGGAACAAATGGATGCTCCCATTGGCACTGGTCTGGACGACATCCTTGAGACGATCAGAATTCAGTGGGAGAGAGATGTTGAAAAGAACCGGGTGGAGGCAGGAGCCCTGCTCCAAGCTAAGCAACAGGCGGAGGTGGCCCACATGTCCCAGACCCAGGAGGAGAAGCTGGCAGCTGCCCTCAGGGTGGAGTTACACAACACTTCGTGCCAAGTCCAGAGCCTCCAGGCTGAGACAGAATCCTTACGTGCCCTGAAACGAGGCCTGGAGAACACCTTGCACGATGCCAAGCACTGGCATGACATGGAGCTCCAGAACCTGGGCGCTGTGGTCGGCCGGCTGGAGGCGGAGCTCAGGGAAATCCGAGCGGAGGCGGAGCAGCAGCAACAGGAGCGCGCGCATCTGCTGGCCCGCAAGTGCCAGCTGCAGAAGGACGTGGCGTCCTACCACGCCCTGCTGGACAGGGAGGAGAGCGGCTGA

Back to List