Details for gene: GCNT2


FALSE


Symbol
GCNT2
Name
glucosaminyl (N-acetyl) transferase 2 (I blood group)
Entrez ID
2651
Ensembl ID
ENSG00000111846    (more details)
KEGG ID
hsa:2651    (more details)
OMIM ID
600429
Uniprot ID
Q8N0V5  
GO ID
hsa:2651    (more details)
Chromosome
6
Strand
1
Start
10492223
End
10629368
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-3187-3p (RPM: 1.1952) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-582-5p (RPM: 8.1398) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-766-5p (RPM: 0.1124) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-331-5p (RPM: 4.2262) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Glycosphingolipid biosynthesis - lacto and neolacto series / Metabolic pathways /
Sequence
ATGATGGGCTCTTGGAAGCACTGTCTTTTTAGCGCGTCTCTTATCTCTGCCCTGATTTTTGTATTTGTTTACAATACTGAGTTATGGGAGAATAAACGTTTTCTGAGGGCAGCTCTGTCCAATGCTTCACTGTTAGCAGAAGCCTGTCATCAGATTTTTGAGGGGAAAGTTTTTTACCCAACAGAAAATGCATTGAAAACTACCCTTGATGAAGCTACCTGCTATGAGTACATGGTTCGAAGCCACTATGTAACAGAAACACTCTCTGAAGAAGAGGCTGGGTTCCCTTTAGCTTACACAGTGACCATCCACAAAGACTTCGGCACTTTTGAGAGGCTCTTCAGGGCGATTTATATGCCCCAAAATGTCTACTGTGTGCACCTGGATCAGAAGGCGACGGATGCCTTTAAAGGTGCAGTGAAACAGTTACTCAGCTGCTTCCCAAATGCTTTTCTGGCTTCCAAGAAGGAGTCGGTTGTCTATGGGGGGATCTCCAGGCTCCAGGCTGACCTGAACTGCCTGGAAGACCTTGTGGCCTCTGAAGTTCCCTGGAAGTATGTCATCAACACCTGCGGGCAAGACTTTCCCCTGAAAACCAACAGGGAAATAGTTCAGTATCTGAAGGGATTTAAAGGGAAAAATATCACCCCCGGAGTGCTGCCTCCTGACCACGCTGTTGGACGGACTAAATACGTCCACCAAGAACTGTTAAACCACAAAAATTCCTACGTGATTAAAACAACAAAATTAAAAACTCCTCCTCCTCATGACATGGTGATTTACTTTGGCACGGCCTACGTGGCTCTCACAAGGGACTTTGCTAACTTCGTCCTCCAAGACCAGCTCGCACTTGACTTACTCTCCTGGTCCAAGGACACCTACAGCCCCGACGAACATTTCTGGGTGACACTCAACAGGATTCCCGGTGTTCCTGGCTCTATGCCAAATGCATCCTGGACTGGAAACCTCAGAGCTATAAAGTGGAGTGACATGGAAGACAGACACGGAGGCTGCCACGGCCACTATGTACATGGTATTTGTATCTATGGAAACGGAGACTTAAAGTGGCTGGTTAATTCACCAAGCCTGTTTGCTAACAAGTTTGAGCTTAATACCTACCCCCTTACTGTGGAATGCCTAGAACTGAGGCATCGCGAAAGAACCCTCAATCAGAGTGAAACTGCGATACAACCCAGCTGGTATTTTTGA

Back to List