Details for gene: GJA3


The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image.


Symbol
GJA3
Name
gap junction protein alpha 3
Entrez ID
2700
Ensembl ID
ENSG00000121743    (more details)
KEGG ID
hsa:2700    (more details)
OMIM ID
121015
Uniprot ID
Q9Y6H8  
GO ID
hsa:2700    (more details)
Chromosome
13
Strand
-1
Start
20138255
End
20161052
miRNA Interactions
hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-149-5p (RPM: 312.3098) / hsa-let-7f-2-3p (RPM: 13.1322) / hsa-miR-3177-5p (RPM: 0.1208) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Glycosphingolipid biosynthesis - lacto and neolacto series / Metabolic pathways / Gap junction trafficking and regulation / Gap junction trafficking / Gap junction assembly / Membrane Trafficking / Vesicle-mediated transport /
Sequence
ATGGGCGACTGGAGCTTTCTGGGAAGACTCTTAGAAAATGCACAGGAGCACTCCACGGTCATCGGCAAGGTTTGGCTGACCGTGCTGTTCATCTTCCGCATCTTGGTGCTGGGGGCCGCGGCGGAGGACGTGTGGGGCGATGAGCAGTCAGACTTCACCTGCAACACCCAGCAGCCGGGCTGCGAGAACGTCTGCTACGACAGGGCCTTCCCCATCTCCCACATCCGCTTCTGGGCGCTGCAGATCATCTTCGTGTCCACGCCCACCCTCATCTACCTGGGCCACGTGCTGCACATCGTGCGCATGGAAGAGAAGAAGAAAGAGAGGGAGGAGGAGGAGCAGCTGAAGAGAGAGAGCCCCAGCCCCAAGGAGCCACCGCAGGACAATCCCTCGTCGCGGGACGACCGCGGCAGGGTGCGCATGGCCGGGGCGCTGCTGCGGACCTACGTCTTCAACATCATCTTCAAGACGCTGTTCGAGGTGGGCTTCATCGCCGGCCAGTACTTTCTGTACGGCTTCGAGCTGAAGCCGCTCTACCGCTGCGACCGCTGGCCCTGCCCCAACACGGTGGACTGCTTCATCTCCAGGCCCACGGAGAAGACCATCTTCATCATCTTCATGCTGGCGGTGGCCTGCGCGTCCCTGCTGCTCAACATGCTGGAGATCTACCACCTGGGCTGGAAGAAGCTCAAGCAGGGCGTGACCAGCCGCCTCGGCCCGGACGCCTCCGAGGCCCCGCTGGGGACAGCCGATCCCCCGCCCCTGCCCCCCAGCTCCCGGCCGCCCGCCGTTGCCATCGGGTTCCCACCCTACTATGCGCACACCGCTGCGCCCCTGGGACAGGCCCGCGCCGTGGGCTACCCCGGGGCCCCGCCACCAGCCGCGGACTTCAAACTGCTAGCCCTGACCGAGGCGCGCGGAAAGGGCCAGTCCGCCAAGCTCTACAACGGCCACCACCACCTGCTGATGACTGAGCAGAACTGGGCCAACCAGGCGGCCGAGCGGCAGCCCCCGGCGCTCAAGGCTTACCCGGCAGCGTCCACGCCTGCAGCCCCCAGCCCCGTCGGCAGCAGCTCCCCGCCACTCGCGCACGAGGCTGAGGCGGGCGCGGCGCCCCTGCTGCTGGATGGGAGCGGCAGCAGTCTGGAGGGGAGCGCCCTGGCAGGGACCCCCGAGGAGGAGGAGCAGGCCGTGACCACCGCGGCCCAGATGCACCAGCCGCCCTTGCCCCTCGGAGACCCAGGTCGGGCCAGCAAGGCCAGCAGGGCCAGCAGCGGGCGGGCCAGACCGGAGGACTTGGCCATCTAG

Back to List