Details for gene: MIP


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
MIP
Name
major intrinsic protein of lens fiber
Entrez ID
4284
Ensembl ID
ENSG00000135517    (more details)
KEGG ID
hsa:4284    (more details)
OMIM ID
154050
Uniprot ID
P30301  
GO ID
hsa:4284    (more details)
Chromosome
12
Strand
-1
Start
56449502
End
56469166
miRNA Interactions
hsa-miR-30a-5p (RPM: 15590.711) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Gap junction assembly / Transport of small molecules / Passive transport by Aquaporins / Aquaporin-mediated transport /
Sequence
ATGTGGGAACTGCGATCAGCCTCCTTTTGGAGGGCCATATTCGCTGAGTTCTTTGCCACCCTCTTCTATGTCTTCTTTGGGCTGGGGTCCTCACTGCGCTGGGCTCCTGGACCCCTGCATGTTCTGCAGGTGGCTATGGCATTTGGCTTGGCCCTGGCTACACTGGTGCAGTCTGTGGGCCACATCAGTGGAGCCCACGTCAATCCTGCAGTCACTTTTGCTTTCCTTGTGGGCTCCCAGATGTCCCTGCTCCGTGCCTTCTGCTATATGGCAGCCCAGCTCCTGGGAGCTGTGGCTGGGGCCGCTGTGCTGTATAGCGTTACCCCACCTGCTGTCCGAGGAAACCTAGCACTCAACACGTTGCACCCTGCGGTGAGCGTGGGCCAGGCAACCACAGTGGAGATCTTCCTGACGCTCCAGTTCGTGCTCTGCATCTTTGCCACATACGACGAGAGGCGGAATGGCCAACTGGGCTCCGTGGCCCTGGCCGTTGGCTTCTCCCTTGCCCTGGGGCACCTCTTTGGGATGTATTATACTGGTGCAGGCATGAATCCTGCCCGCTCCTTTGCTCCTGCCATTCTCACTGGGAACTTCACTAACCACTGGGTGTACTGGGTAGGCCCAATCATTGGAGGGGGTCTGGGCAGCCTCCTGTACGACTTTCTTCTCTTCCCCCGGCTCAAGAGTATTTCTGAGAGACTGTCTGTCCTCAAGGGTGCCAAACCCGATGTCTCCAATGGACAACCAGAGGTCACAGGGGAACCTGTTGAACTGAACACCCAGGCCCTGTAG

Back to List