Details for gene: CRYAB


The action of a molecule that contributes to the structural integrity of the lens of an eye.


Symbol
CRYAB
Name
crystallin alpha B
Entrez ID
1410
Ensembl ID
ENSG00000109846    (more details)
KEGG ID
hsa:1410    (more details)
OMIM ID
123590
Uniprot ID
P02511  
GO ID
hsa:1410    (more details)
Chromosome
11
Strand
-1
Start
111908564
End
111923722
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-4738-3p (RPM: 0.3144) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Protein processing in endoplasmic reticulum / Passive transport by Aquaporins / Cellular responses to stress / Cellular response to heat stress / HSF1-dependent transactivation / Cellular responses to external stimuli / Longevity regulating pathway - multiple species /
Sequence
ATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCCAGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACGTCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGTTTGACACTGGACTCTCAGAGATGCGCCTGGAGAAGGACAGGTTCTCTGTCAACCTGGATGTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGTTGGGAGATGTGATTGAGGTGCATGGAAAACATGAAGAGCGCCAGGATGAACATGGTTTCATCTCCAGGGAGTTCCACAGGAAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGATGGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAG

Back to List