Details for gene: FYCO1


Interacting selectively and non-covalently with any metal ion.


Symbol
FYCO1
Name
FYVE and coiled-coil domain autophagy adaptor 1
Entrez ID
79443
Ensembl ID
ENSG00000163820    (more details)
KEGG ID
hsa:79443    (more details)
OMIM ID
607182
Uniprot ID
Q9BQS8  
GO ID
hsa:79443    (more details)
Chromosome
3
Strand
-1
Start
45917903
End
45995824
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-548at-5p (RPM: 0.3546) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-4803 (RPM: 0.0328) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-4326 (RPM: 2.7166) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-3662 (RPM: 0.0344) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-582-5p (RPM: 8.1398) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-578 (RPM: 0.0174) / hsa-miR-520c-3p (RPM: 0.0046) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-2467-5p (RPM: 3.8758) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-372-3p (RPM: 0.0034) / hsa-miR-548k (RPM: 8.758) / hsa-miR-520f-3p (RPM: 0.0042) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-520a-3p (RPM: 0.0858) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-548n (RPM: 0.0924) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-548l (RPM: 0.078) / hsa-miR-362-3p (RPM: 1.4456) / hsa-miR-3679-5p (RPM: 0.274) / hsa-miR-4511 (RPM: 0.216) / hsa-miR-302c-3p (RPM: 0.0012) / hsa-miR-502-5p (RPM: 0.9904) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-548h-5p (RPM: 0.3692) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-142-3p (RPM: 8.3404) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-1253 (RPM: 0.0136) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-148b-5p (RPM: 20.6792) / hsa-miR-561-3p (RPM: 0.023) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-212-5p (RPM: 3.5846) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-1267 (RPM: 0.087) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-3160-5p (RPM: 0.0012) / hsa-miR-504-5p (RPM: 27.4444) / hsa-miR-550a-3-5p (RPM: 3.3892) / hsa-miR-550a-5p (RPM: 2.9716) / hsa-miR-3189-3p (RPM: 0.0248) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-340-3p (RPM: 15.2654) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-6770-5p (RPM: 0.0456) / hsa-miR-1252-3p (RPM: 0.0174) / hsa-miR-6827-3p (RPM: 0.0306) / hsa-miR-3605-3p (RPM: 17.6796) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Salmonella infection /
Sequence
ATGGCCTCCACCAATGCAGAGAGCCAGCTCCAGAGAATCATCCGAGACTTGCAAGATGCTGTGACAGAACTAAGCAAAGAATTTCAGGAAGCAGGGGAACCCATCACGGATGACAGCACCAGCTTGCATAAATTTTCTTATAAACTTGAGTATCTCCTGCAATTTGATCAGAAAGAGAAGGCCACCCTCCTGGGCAACAAGAAGGACTACTGGGATTACTTCTGTGCCTGCCTGGCCAAGGTGAAAGGAGCCAATGATGGGATCCGCTTTGTCAAGTCTATCTCAGAGCTCCGAACATCCTTGGGGAAAGGAAGAGCATTTATTCGCTACTCCTTGGTGCACCAGAGGTTGGCAGACACCTTACAGCAGTGCTTCATGAACACCAAAGTGACCAGTGACTGGTACTATGCAAGAAGCCCCTTTCTGCAGCCAAAGCTGAGCTCGGACATTGTGGGCCAACTCTATGAGCTGACTGAGGTTCAGTTTGACCTGGCGTCGAGGGGCTTTGACTTGGATGCTGCCTGGCCAACATTTGCCAGGAGGACGCTGACCACTGGCTCTTCTGCTTACCTGTGGAAACCCCCTAGCCGCAGCTCCAGCATGAGCAGCTTGGTGAGCAGCTACCTGCAGACTCAAGAGATGGTGTCCAACTTTGACCTGAACAGCCCCCTAAACAACGAGGCATTGGAGGGCTTTGATGAGATGCGACTAGAGCTGGACCAGTTGGAGGTGCGGGAGAAGCAGCTACGGGAGCGCATGCAGCAGCTGGACAGAGAGAACCAGGAGCTGAGGGCAGCTGTCAGCCAGCAAGGGGAGCAACTGCAGACAGAGAGGGAGAGGGGGCGCACTGCAGCGGAGGACAACGTTCGCCTCACTTGCTTGGTAGCTGAGCTCCAGAAGCAGTGGGAGGTCACCCAGGCCACCCAGAACACTGTGAAGGAGCTGCAGACATGCCTGCAGGGCCTGGAGCTAGGAGCAGCAGAGAAGGAGGAGGACTACCACACAGCCCTGCGGCGGCTGGAGTCCATGCTGCAGCCCTTGGCACAGGAGCTTGAGGCCACACGGGACTCACTGGACAAGAAAAACCAGCATTTAGCCAGCTTCCCAGGCTGGCTAGCCATGGCTCAGCAGAAGGCAGATACGGCATCAGACACAAAGGGCCGGCAAGAACCTATTCCCAGTGATGCGGCCCAGGAGATGCAGGAGCTAGGGGAGAAGCTTCAAGCCCTAGAAAGGGAGAGAACCAAGGTCGAGGAGGTCAACAGACAGCAGAGTGCCCAACTGGAACAGCTGGTCAAGGAGCTTCAGCTGAAAGAGGATGCCCGGGCCAGCCTGGAGCGCCTGGTGAAGGAGATGGCCCCACTCCAGGAGGAGTTGTCTGGGAAGGGACAGGAGGCAGACCAGCTCTGGCGACGGCTGCAGGAGTTGCTGGCCCACACGAGCTCCTGGGAGGAGGAGCTAGCAGAGTTGAGGCGGGAGAAAAAACAGCAACAGGAGGAGAAGGAGCTGCTGGAGCAGGAGGTCAGGTCTCTGACCCGGCAGCTGCAGTTCCTGGAGACCCAGCTGGCACAGGTGAGCCAACATGTGAGTGACCTGGAGGAGCAGAAGAAGCAGCTCATTCAGGACAAAGACCACCTCAGCCAGCAGGTGGGTATGCTCGAGCGGCTTGCTGGGCCGCCTGGCCCAGAACTGCCAGTGGCAGGTGAGAAGAATGAGGCCCTGGTCCCTGTGAACTCCAGTCTGCAAGAGGCCTGGGGGAAGCCAGAGGAGGAGCAGAGGGGCCTGCAGGAGGCACAGTTAGACGATACCAAGGTGCAAGAGGGCAGCCAGGAGGAAGAGCTCCGGCAGGCCAACAGGGAGCTGGAGAAGGAGCTACAGAATGTGGTCGGGCGTAACCAGCTCCTGGAGGGCAAGCTGCAAGCCCTGCAGGCCGATTACCAGGCTTTGCAGCAGCGGGAATCAGCCATCCAGGGCTCCTTGGCCTCCCTGGAGGCCGAGCAGGCCAGCATCCGGCACTTGGGTGACCAGATGGAGGCGAGCTTGCTGGCTGTAAGGAAGGCCAAGGAGGCCATGAAAGCCCAGATGGCAGAGAAGGAGGCCATTCTACAGAGCAAGGAGGGCGAGTGTCAGCAGCTGCGGGAGGAGGTGGAGCAGTGCCAGCAACTGGCAGAAGCCCGGCACAGAGAGCTTAGGGCTCTCGAGAGCCAGTGCCAGCAGCAGACCCAGCTGATTGAGGTCCTCACAGCAGAGAAAGGCCAACAGGGAGTTGGCCCACCCACTGACAATGAAGCCCGTGAGCTGGCTGCCCAGCTAGCCCTGTCTCAGGCGCAGCTGGAAGTCCATCAGGGGGAGGTCCAACGGCTGCAGGCTCAGGTGGTGGACCTCCAGGCCAAGATGCGGGCAGCCCTGGATGACCAGGACAAGGTGCAGAGCCAGCTAAGCATGGCTGAGGCCGTCCTGAGGGAGCACAAAACCCTTGTGCAGCAGCTGAAGGAGCAGAATGAAGCCCTTAACAGAGCCCATGTCCAGGAGCTGCTGCAATGCTCGGAGCGTGAAGGGGCACTGCAGGAGGAGAGGGCCGATGAGGCCCAGCAGAGGGAGGAGGAGCTGCGGGCCCTGCAGGAGGAGCTGTCCCAGGCCAAATGCAGCTCCGAGGAAGCACAGCTGGAGCACGCTGAGCTGCAAGAGCAGCTGCACCGGGCCAACACAGACACAGCTGAGCTGGGCATCCAGGTTTGCGCACTGACCGTGGAAAAGGAGCGAGTGGAGGAGGCACTGGCCTGTGCTGTCCAGGAGCTCCAGGACGCCAAAGAGGCAGCCTCAAGGGAGCGAGAGGGCCTGGAGCGCCAAGTAGCTGGGCTGCAGCAAGAGAAGGAGAGCTTGCAGGAGAAGCTGAAGGCGGCCAAGGCAGCAGCCGGCTCACTGCCTGGCCTGCAGGCCCAGCTCGCCCAGGCAGAGCAGCGGGCCCAGAGCCTCCAAGAGGCTGCACACCAGGAGCTCAACACCCTCAAGTTCCAGCTGAGTGCTGAAATCATGGACTACCAGAGCAGACTTAAGAATGCTGGTGAAGAGTGCAAGAGCCTCAGGGGCCAGCTTGAGGAGCAAGGCCGGCAGCTGCAGGCTGCTGAGGAAGCTGTGGAGAAGCTGAAGGCCACCCAAGCAGACATGGGAGAGAAGCTGAGCTGCACTAGCAACCATCTTGCAGAGTGCCAGGCGGCCATGCTGAGGAAGGACAAGGAGGGGGCTGCCCTGCGTGAAGACCTAGAAAGGACCCAGAAGGAACTCGAAAAAGCCACAACAAAAATCCAAGAGTATTACAACAAACTCTGCCAGGAGGTGACAAATCGTGAGAGGAATGACCAGAAGATGCTTGCTGACCTGGATGACCTCAACAGAACCAAGAAGTATCTCGAGGAGCGGCTGATAGAGCTGCTCAGGGACAAGGATGCTCTCTGGCAGAAGTCAGATGCCCTGGAATTCCAGCAGAAGCTCAGTGCTGAGGAGAGATGGCTCGGAGACACAGAGGCAAACCACTGCCTCGACTGTAAGCGGGAGTTCAGCTGGATGGTGCGGCGGCACCACTGCAGGATATGTGGCCGCATCTTCTGTTACTACTGCTGCAACAACTACGTCCTGAGCAAGCACGGTGGCAAAAAGGAGCGCTGCTGCCGAGCCTGTTTCCAGAAGCTCAGTGAAGGCCCTGGCTCCCCTGATAGCAGTGGCTCAGGCACTAGCCAGGGAGAGCCCAGCCCTGCACTGTCACCAGCCTCACCTGGGCCCCAGGCCACAGGAGGCCAAGGAGCAAATACAGACTACAGGCCACCGGACGACGCTGTGTTTGATATCATCACAGATGAGGAATTGTGCCAGATACAGGAGTCCGGCTCCTCTTTGCCTGAAACACCCACTGAAACTGATTCTCTCGACCCAAATGCGGCTGAACAGGATACTACATCAACCTCGCTAACGCCTGAGGACACTGAAGACATGCCCGTGGGGCAGGATTCGGAAATCTGCCTGCTGAAGTCTGGAGAACTGATGATCAAAGTACCCCTCACAGTGGATGAGATCGCCAGCTTCGGGGAGGGTAGCAGGGAGCTGTTTGTGAGGTCCAGCACCTACAGCCTGATCCCCATCACTGTGGCCGAGGCAGGCCTCACCATCAGCTGGGTCTTCTCCTCTGACCCCAAGAGCATCTCCTTCAGTGTGGTCTTCCAGGAGGCCGAGGACACACCGCTGGATCAGTGTAAGGTCCTCATTCCCACGACCCGATGCAACTCCCACAAGGAGAACATCCAGGGCCAGCTCAAGGTTCGCACACCCGGCATCTACATGCTCATCTTCGACAATACCTTCTCAAGGTTTGTCTCTAAAAAGGTATTTTATCACTTGACGGTTGATCGGCCTGTGATCTACGATGGAAGTGATTTCCTGTAG

Back to List