Details for gene: LIM2


The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane.


Symbol
LIM2
Name
lens intrinsic membrane protein 2
Entrez ID
3982
Ensembl ID
ENSG00000105370    (more details)
KEGG ID
hsa:3982    (more details)
OMIM ID
154045
Uniprot ID
P55344  
GO ID
hsa:3982    (more details)
Chromosome
19
Strand
-1
Start
51379909
End
51387974
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGTACAGCTTCATGGGTGGTGGCCTGTTCTGTGCCTGGGTGGGGACCATCCTCCTGGTGGTGGCCATGGCAACAGACCACTGGATGCAGTACCGGCTGTCAGGGTCCTTCGCCCACCAGGGCCTGTGGCGGTACTGCCTGGGCAACAAGTGCTACCTGCAGACAGACAGCATCGCATACTGGAATGCCACCCGGGCCTTCATGATCCTGTCTGCCCTATGCGCCATCTCCGGCATCATCATGGGCATCATGGCCTTCGCTCATCAGCCTACCTTCTCCCGCATCTCCCGGCCCTTCTCTGCTGGCATCATGTTTTTTTCCTCAACCCTTTTCGTCGTGTTGGCCTTGGCCATCTACACTGGAGTCACCGTCAGCTTCCTGGGCCGCCGCTTTGGGGACTGGCGCTTTTCCTGGTCCTACATCCTGGGCTGGGTGGCAGTGCTCATGACGTTCTTCGCAGGGATTTTCTACATGTGCGCCTACCGGGTGCATGAATGCCGGCGCCTGTCTACACCCCGCTGA

Back to List