Details for gene: CRYBB3


The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image.


Symbol
CRYBB3
Name
crystallin beta B3
Entrez ID
1417
Ensembl ID
ENSG00000100053    (more details)
KEGG ID
hsa:1417    (more details)
OMIM ID
123630
Uniprot ID
P26998  
GO ID
hsa:1417    (more details)
Chromosome
22
Strand
1
Start
25199858
End
25207359
miRNA Interactions
hsa-miR-147a (RPM: 0.0014) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Transcriptional misregulation in cancer / Inflammatory bowel disease (IBD) /
Sequence
ATGGCGGAACAGCACGGAGCACCCGAACAGGCTGCAGCTGGCAAGAGCCATGGAGACCTTGGGGGCAGCTACAAGGTGATCTTGTACGAACTAGAGAACTTCCAAGGCAAACGCTGCGAGCTCTCGGCCGAGTGCCCCAGCCTGACCGACAGCCTGCTGGAGAAGGTGGGCTCCATCCAAGTGGAGTCCGGGCCGTGGCTGGCATTTGAGTCCAGGGCCTTCCGCGGGGAGCAGTTTGTTCTGGAGAAGGGGGATTATCCTCGCTGGGATGCCTGGTCCAACAGCCGTGATAGTGACAGCCTTCTGTCCCTCCGGCCTCTGAATATTGATAGTCCACATCACAAGCTGCATCTGTTTGAGAACCCAGCTTTCAGTGGCCGCAAGATGGAGATAGTGGATGATGACGTGCCCAGCCTGTGGGCTCATGGCTTCCAGGACCGTGTGGCGAGTGTCCGTGCCATCAACGGGACGTGGGTTGGCTATGAGTTCCCCGGCTACCGTGGGCGCCAGTACGTGTTTGAGCGGGGCGAGTACCGCCACTGGAATGAGTGGGACGCCAGCCAGCCGCAGCTGCAGTCTGTGCGCCGCATCCGTGACCAGAAGTGGCACAAGCGGGGCCGCTTCCCCAGCAGCTGA

Back to List