Details for gene: VIM


A cytoskeletal structure that forms a distinct elongated structure, characteristically 10 nm in diameter, that occurs in the cytoplasm of eukaryotic cells. Intermediate filaments form a fibrous system, composed of chemically heterogeneous subunits and involved in mechanically integrating the various components of the cytoplasmic space. Intermediate filaments may be divided into five chemically distinct classes: Type I, acidic keratins; Type II, basic keratins; Type III, including desmin, vimentin and others; Type IV, neurofilaments and related filaments; and Type V, lamins.


Symbol
VIM
Name
vimentin
Entrez ID
7431
Ensembl ID
ENSG00000026025    (more details)
KEGG ID
hsa:7431    (more details)
OMIM ID
193060
Uniprot ID
P08670  
GO ID
hsa:7431    (more details)
Chromosome
10
Strand
1
Start
17228241
End
17237593
miRNA Interactions
hsa-miR-548ar-3p (RPM: 0.052) / hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-216a-5p (RPM: 20.4176) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-548f-3p (RPM: 0.277) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-506-3p (RPM: 0.6452) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-3613-3p (RPM: 0.8106) / hsa-miR-4745-5p (RPM: 0.481) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-103a-2-5p (RPM: 0.387) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-548a-3p (RPM: 0.0396) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-548e-3p (RPM: 1.2898) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-5699-3p (RPM: 0.4822) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-125b-2-3p (RPM: 492.7724) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-9-5p (RPM: 3525.806) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-153-3p (RPM: 53.4548) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-548n (RPM: 0.0924) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-3135b (RPM: 0.0038) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-28-3p (RPM: 1489.665) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-1287-5p (RPM: 8.4442) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-4668-5p (RPM: 0.092) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-148b-5p (RPM: 20.6792) / hsa-miR-708-3p (RPM: 46.9334) / hsa-miR-5682 (RPM: 0.013) / hsa-miR-561-3p (RPM: 0.023) / hsa-miR-5196-3p (RPM: 0.011) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-31-3p (RPM: 2.995) / hsa-miR-5581-3p (RPM: 0.3204) / hsa-miR-1277-3p (RPM: 0.1324) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-874-3p (RPM: 170.3494) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-16-2-3p (RPM: 15.7658) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-675-5p (RPM: 0.6068) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-609 (RPM: 0.0286) / hsa-miR-135b-3p (RPM: 2.2482) / hsa-miR-134-5p (RPM: 29.8712) / hsa-miR-424-3p (RPM: 2.2264) / hsa-miR-34a-3p (RPM: 0.9902) / hsa-miR-550a-3p (RPM: 2.5866) / hsa-miR-363-5p (RPM: 0.4074) / hsa-miR-4328 (RPM: 0.0008) / hsa-miR-374b-3p (RPM: 5.4276) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-500a-3p (RPM: 426.0306) / hsa-miR-95-3p (RPM: 9.9932) / hsa-miR-450a-5p (RPM: 1.7656) / hsa-miR-1306-3p (RPM: 0.8504) / hsa-miR-548e-5p (RPM: 0.4844) / hsa-miR-3605-3p (RPM: 17.6796) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Epstein-Barr virus infection / MicroRNAs in cancer / Apoptosis / Apoptotic cleavage of cellular proteins / Cytokine Signaling in Immune system / Macroautophagy / Immune System / Caspase-mediated cleavage of cytoskeletal proteins / Striated Muscle Contraction / Muscle contraction / Signaling by Interleukins / Programmed Cell Death / Interleukin-4 and Interleukin-13 signaling / Apoptotic execution phase / Autophagy / Chaperone Mediated Autophagy / Late endosomal microautophagy / Aggrephagy / Selective autophagy / RHOBTB1 GTPase cycle /
Sequence
ATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAGGACATCATGCGCCTCCGGGAGAAATTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAAAACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAA

Back to List