Details for gene: CHMP4B


The directed movement of substances into, out of or within a vacuole.


Symbol
CHMP4B
Name
charged multivesicular body protein 4B
Entrez ID
128866
Ensembl ID
ENSG00000101421    (more details)
KEGG ID
hsa:128866    (more details)
OMIM ID
610897
Uniprot ID
Q9H444  
GO ID
hsa:128866    (more details)
Chromosome
20
Strand
1
Start
33811348
End
33854366
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-216a-5p (RPM: 20.4176) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-922 (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-770-5p (RPM: 1.245) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-3678-3p (RPM: 0.0274) / hsa-miR-2467-3p (RPM: 0.0206) / hsa-miR-33a-3p (RPM: 1.692) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-31-3p (RPM: 2.995) / hsa-miR-5586-3p (RPM: 0.0056) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-345-5p (RPM: 317.5696) / hsa-miR-6838-5p (RPM: 0.079) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Epstein-Barr virus infection / MicroRNAs in cancer / Endocytosis / Membrane Trafficking / Vesicle-mediated transport / Macroautophagy / Autophagy / Late endosomal microautophagy / HIV Life Cycle / Budding and maturation of HIV virion / Late Phase of HIV Life Cycle / HIV Infection / Cell Cycle / Disease / Mitotic Metaphase and Anaphase / Nuclear Envelope (NE) Reassembly / Infectious disease / Mitotic Anaphase / M Phase / Cell Cycle, Mitotic / Endosomal Sorting Complex Required For Transport (ESCRT) / HCMV Infection / HCMV Late Events / Sealing of the nuclear envelope (NE) by ESCRT-III / SARS-CoV-1 Infection / Translation of Replicase and Assembly of the Replication Transcription Complex / SARS-CoV Infections / SARS-CoV-2 Infection / Pyroptosis / Translation of Replicase and Assembly of the Replication Transcription Complex / Necroptosis /
Sequence
ATGTCGGTGTTCGGGAAGCTGTTCGGGGCTGGAGGGGGTAAGGCCGGCAAGGGCGGCCCGACCCCCCAGGAGGCCATCCAGCGGCTGCGGGACACGGAAGAGATGTTAAGCAAGAAACAGGAGTTCCTGGAGAAGAAAATCGAGCAGGAGCTGACGGCCGCCAAGAAGCACGGCACCAAAAACAAGCGCGCGGCCCTCCAGGCACTGAAGCGTAAGAAGAGGTATGAGAAGCAGCTGGCGCAGATCGACGGCACATTATCAACCATCGAGTTCCAGCGGGAGGCCCTGGAGAATGCCAACACCAACACCGAGGTGCTCAAGAACATGGGCTATGCCGCCAAGGCCATGAAGGCGGCCCATGACAACATGGACATCGATAAAGTTGATGAGTTAATGCAGGACATTGCTGACCAGCAAGAACTTGCAGAGGAGATTTCAACAGCAATTTCGAAACCTGTAGGGTTTGGAGAAGAGTTTGACGAGGATGAGCTCATGGCGGAATTAGAAGAACTAGAACAGGAGGAACTAGACAAGAATTTGCTGGAAATCAGTGGACCCGAAACAGTCCCTCTACCAAATGTTCCCTCTATAGCCCTACCATCAAAACCCGCCAAGAAGAAAGAAGAGGAGGACGACGACATGAAGGAATTGGAGAACTGGGCTGGATCCATGTAA

Back to List