Details for gene: BFSP1


The action of a molecule that contributes to the structural integrity of the lens of an eye.


Symbol
BFSP1
Name
beaded filament structural protein 1
Entrez ID
631
Ensembl ID
ENSG00000125864    (more details)
KEGG ID
hsa:631    (more details)
OMIM ID
603307
Uniprot ID
Q12934  
GO ID
hsa:631    (more details)
Chromosome
20
Strand
-1
Start
17493905
End
17569220
miRNA Interactions
hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Endocytosis /
Sequence
ATGTACCGGCGCAGCTACGTCTTCCAGACCCGCAAGGAGCAGTACGAGCACGCCGACGAGGCTTCGCGCGCCGCCGAGCCCGAGCGCCCGGCCGACGAGGGCTGGGCTGGGGCAACGAGCCTGGCGGCGCTGCAGGGGCTCGGCGAGCGCGTGGCCGCCCACGTCCAGCGGGCCCGCGCCCTCGAGCAGCGCCATGCCGGGCTCCGGAGGCAGCTGGATGCCTTCCAGCGCCTGGGCGAGCTGGCCGGGCCCGAGGACGCCCTCGCCCGCCAAGTCGAGAGCAACCGCCAGCGCGTCCGGGACCTGGAGGCCGAGCGCGCCCGGCTGGAGCGCCAGGGCACCGAGGCGCAGCGCGCGCTCGACGAGTTCCGAAGCAAGTATGAAAATGAGTGCGAATGTCAACTCCTGCTAAAAGAAATGCTTGAACGGCTTAACAAGGAAGCTGATGAAGCCTTGCTGCATAACCTACGCCTTCAGCTGGAAGCCCAATTTCTGCAAGATGATATCAGTGCGGCAAAGGACAGGCACAAGAAGAATCTTCTGGAAGTTCAGACCTATATCAGCATCCTGCAGCAGATCATCCACACCACTCCTCCAGCATCCATTGTGACGAGTGGGATGAGGGAGGAGAAGCTCCTGACGGAGCGGGAGGTGGCCGCCCTGCGGAGTCAGCTGGAGGAGGGCCGGGAGGTGCTCTCCCACCTGCAGGCGCAGAGAGTGGAGCTGCAGGCACAGACAACAACTCTGGAACAAGCTATTAAAAGTGCCCATGAGTGTTATGACGATGAGATTCAGCTTTATAACGAGCAGATTGAGACACTGCGCAAGGAGATTGAGGAGACAGAGCGGGTCCTGGAGAAGTCTTCTTACGACTGCCGGCAGCTGGCGGTCGCCCAGCAAACCCTGAAGAATGAGCTGGACCGGTATCATCGTATCATCGAGATTGAAGGCAACAGGCTGACCTCTGCCTTCATTGAAACTCCCATTCCCCTGTTCACCCAGAGCCATGGAGTCTCTCTCAGCACTGGATCCGGTGGGAAAGATCTTACCAGAGCTCTGCAGGATATAACAGCAGCAAAACCAAGACAAAAAGCCCTCCCCAAGAATGTTCCAAGGAGAAAAGAGATTATAACAAAAGACAAAACCAACGGAGCTCTGGAAGATGCACCATTAAAAGGTTTGGAAGACACAAAGCTGGTACAGGTGGTACTTAAAGAGGAAAGTGAATCTAAGTTTGAATCAGAAAGTAAAGAAGTAAGTCCCCTGACACAAGAAGGGGCTCCAGAGGATGTGCCAGATGGAGGGCAGATAAGCAAAGGCTTTGGGAAACTATACAGGAAGGTCAAGGAGAAAGTGAGAAGCCCCAAAGAGCCTGAGACCCCCACTGAGCTCTACACCAAAGAGCGGCACGTGCTGGTCACAGGGGATGCCAATTACGTGGACCCTAGATTCTATGTCTCCTCCATCACAGCTAAAGGTGGGGTGGCTGTTTCTGTTGCGGAAGACTCTGTGCTTTATGACGGCCAGGTGGAGCCCTCTCCTGAGTCACCCAAGCCCCCTTTAGAGAATGGGCAGGTGGGTCTGCAGGAGAAAGAAGATGGACAACCAATTGACCAGCAGCCTATAGACAAGGAGATTGAGCCAGATGGTGCAGAGCTGGAAGGCCCTGAAGAGAAACGTGAGGGTGAGGAGCGGGACGAAGAGTCCAGGAGACCCTGTGCCATGGTCACACCCGGTGCAGAGGAACCATCTATACCTGAGCCTCCAAAGCCTGCGGCTGATCAGGATGGAGCTGAGGTGCTTGGGACTAGGAGCAGAAGCCTGCCAGAAAAAGGCCCTCCCAAGGCTTTGGCCTATAAGACAGTGGAAGTGGTGGAATCTATCGAGAAGATTTCCACGGAGAGCATTCAGACATATGAAGAAACCGCTGTGATCGTGGAGACCATGATTGGAAAGACAAAGTCAGACAAGAAGAAATCAGGAGAGAAGAGCTCTTAA

Back to List