Details for gene: FOXE3


Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.


Symbol
FOXE3
Name
forkhead box E3
Entrez ID
2301
Ensembl ID
ENSG00000186790    (more details)
KEGG ID
hsa:2301    (more details)
OMIM ID
601094
Uniprot ID
Q13461  
GO ID
hsa:2301    (more details)
Chromosome
1
Strand
1
Start
47416285
End
47418052
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGCGGGGCGCAGCGACATGGATCCGCCCGCCGCGTTCTCTGGCTTCCCTGCCCTGCCAGCGGTCGCGCCGTCGGGGCCGCCGCCGTCGCCGCTCGCAGGAGCCGAGCCAGGGCGGGAGCCAGAGGAGGCGGCGGCTGGCCGCGGAGAGGCGGCCCCCACGCCCGCGCCCGGCCCGGGGCGGCGGCGGCGGCGGCCCCTGCAGCGCGGGAAGCCGCCCTACTCGTACATCGCGCTCATCGCCATGGCTCTGGCGCACGCCCCGGGCCGCCGCCTCACGCTGGCCGCCATCTACCGCTTCATCACCGAACGCTTTGCCTTCTACCGCGACAGCCCGCGCAAGTGGCAGAACAGCATCCGCCACAATCTCACGCTCAACGACTGCTTCGTCAAGGTGCCCCGCGAGCCGGGCAACCCGGGCAAGGGCAACTACTGGACGCTGGACCCCGCGGCCGCAGACATGTTCGACAACGGCAGCTTCCTGCGGCGCCGCAAGCGCTTCAAGCGCGCCGAGCTGCCCGCGCACGCGGCCGCGGCGCCAGGGCCGCCGCTCCCCTTCCCCTACGCGCCCTACGCGCCCGCGCCCGGCCCCGCGCTGCTGGTGCCGCCGCCTTCTGCCGGACCGGGCCCCTCGCCGCCCGCGCGTCTGTTCAGCGTCGACAGCCTGGTGAACCTGCAGCCGGAGCTAGCGGGGCTGGGCGCCCCCGAGCCGCCCTGCTGCGCCGCGCCCGACGCCGCAGCCGCAGCCTTCCCGCCCTGCGCTGCCGCCGCCTCCCCGCCACTCTACTCGCAGGTCCCCGACCGCCTGGTACTGCCCGCGACGCGCCCCGGCCCCGGCCCGCTGCCCGCTGAGCCCCTCCTGGCCTTGGCCGGGCCGGCAGCCGCTCTCGGCCCGCTCAGCCCTGGGGAGGCCTACCTGAGGCAGCCGGGCTTCGCGTCGGGGCTGGAGCGCTACCTGTGA

Back to List