Details for gene: TDRD7


Interacting selectively and non-covalently with an RNA molecule or a portion thereof.


Symbol
TDRD7
Name
tudor domain containing 7
Entrez ID
23424
Ensembl ID
ENSG00000196116    (more details)
KEGG ID
hsa:23424    (more details)
OMIM ID
611258
Uniprot ID
Q8NHU6  
GO ID
hsa:23424    (more details)
Chromosome
9
Strand
1
Start
97412096
End
97496125
miRNA Interactions
hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-452-5p (RPM: 23.696) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-1305 (RPM: 0.128) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-505-5p (RPM: 1.7508) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-1179 (RPM: 0.9322) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-132-5p (RPM: 5.9596) /
Involved Diseases
cataract / age-related cataract / glaucoma / Volkmann cataract /
Involved Pathways
Protein processing in endoplasmic reticulum /
Sequence
ATGCTGGAAGGAGATCTGGTTTCAAAGATGCTACGAGCTGTTCTGCAGTCTCATAAGAATGGAGTAGCATTACCCCGGCTCCAAGGAGAGTACAGATCCTTGACTGGAGACTGGATCCCCTTCAAACAGCTAGGTTTCCCTACACTAGAAGCCTATCTGAGAAGTGTGCCAGCAGTGGTCAGGATAGAGACTAGTAGATCTGGAGAGATTACCTGCTATGCCATGGCCTGCACAGAAACTGCAAGAATTGCTCAGCTTGTGGCTCGTCAAAGGAGTTCTAAAAGGAAAACCGGGCGTCAAGTTAATTGTCAGATGAGAGTGAAGAAAACCATGCCATTTTTTCTAGAAGGAAAACCAAAAGCAACCCTCAGACAACCAGGATTTGCTTCAAATTTTTCTGTTGGCAAAAAACCTAATCCAGCACCGTTAAGAGACAAAGGAAACTCTGTTGGAGTTAAGCCTGATGCTGAAATGTCTCCTTATATGCTACACACAACTCTTGGAAATGAAGCATTCAAAGACATTCCAGTGCAAAGGCATGTGACCATGTCCACCAACAACAGGTTTAGCCCAAAGGCGTCCCTTCAACCACCTTTGCAGATGCATCTCTCAAGAACCTCTACTAAGGAAATGAGTGATAATTTAAATCAGACTGTTGAAAAACCCAATGTCAAGCCTCCTGCCTCTTACACTTATAAAATGGATGAGGTTCAAAATCGCATAAAGGAAATACTAAACAAGCATAACAATGGCATTTGGATATCTAAGCTTCCACATTTTTACAAAGAGTTATATAAAGAAGACCTTAATCAAGGAATTTTACAACAGTTTGAACACTGGCCTCATATTTGCACGGTGGAGAAACCTTGCAGTGGTGGCCAAGATTTACTTCTTTATCCAGCTAAGAGAAAGCAGCTTTTGAGAAGTGAACTGGATACTGAGAAAGTACCTCTATCCCCACTACCTGGTCCCAAACAAACACCACCGTTGAAAGGGTGTCCAACAGTTATGGCAGGAGACTTTAAAGAAAAAGTGGCAGACCTGCTGGTGAAATACACAAGTGGCCTTTGGGCCAGTGCACTTCCGAAAGCATTTGAGGAAATGTACAAAGTGAAATTCCCTGAGGATGCCTTAAAAAATCTTGCCTCACTTTCTGATGTATGCAGCATAGACTACATTTCTGGAAATCCCCAGAAGGCCATTCTCTATGCTAAACTTCCATTGCCCACTGACAAAATCCAAAAGGATGCAGGGCAAGCACATGGTGATAATGATATCAAGGCTATGGTTGAACAAGAGTATTTGCAGGTAGAAGAAAGCATTGCTGAAAGTGCTAATACCTTTATGGAGGACATAACAGTTCCTCCTTTAATGATTCCAACTGAAGCATCACCATCTGTATTGGTGGTTGAACTGAGCAACACAAATGAAGTGGTTATCAGGTATGTGGGCAAAGACTATTCTGCTGCTCAGGAATTAATGGAAGATGAGATGAAGGAATATTACAGTAAGAATCCTAAGATCACACCAGTCCAGGCTGTGAATGTTGGGCAGTTGCTGGCCGTAAATGCCGAGGAGGACGCCTGGTTACGGGCACAGGTCATCTCAACAGAAGAGAACAAAATAAAGGTATGCTATGTTGACTATGGTTTTAGTGAAAATGTTGAAAAAAGCAAAGCATACAAATTAAACCCGAAGTTTTGTTCACTCTCATTTCAAGCTACAAAATGTAAGCTTGCAGGCTTGGAAGTCCTAAGCGATGACCCTGATCTAGTGAAGGTGGTTGAATCTTTAACTTGTGGAAAGATCTTTGCAGTGGAAATACTTGACAAAGCTGACATTCCACTTGTTGTTCTGTACGATACCTCAGGAGAAGATGATATCAATATCAATGCCACCTGCTTGAAGGCTATATGTGACAAGTCACTAGAGGTTCACCTGCAGGTTGACGCCATGTACACAAATGTCAAAGTAACTAATATTTGCTCTGATGGGACACTCTACTGCCAGGTGCCTTGTAAGGGTCTGAACAAGCTCAGTGACCTTCTACGTAAGATAGAGGACTACTTCCATTGCAAGCACATGACCTCTGAGTGCTTTGTTTCATTACCCTTCTGTGGGAAAATCTGCCTCTTCCATTGCAAAGGAAAATGGTTACGAGTAGAGATCACAAATGTTCACAGCAGCCGGGCTCTTGATGTTCAGTTCCTGGACTCTGGCACTGTGACATCTGTAAAAGTGTCAGAGCTCAGGGAAATTCCACCTCGGTTTCTACAAGAAATGATTGCAATACCACCTCAGGCCATTAAGTGCTGTTTAGCAGATCTTCCACAATCTATTGGCATGTGGACACCAGATGCAGTGCTGTGGTTAAGAGATTCTGTTTTGAATTGCTCGGACTGTAGCATTAAGGTTACAAAAGTGGATGAAACCAGAGGGATCGCACATGTTTATTTATTTACCCCTAAGAACTTCCCTGACCCTCATCGCAGTATTAATCGCCAGATTACAAATGCAGACTTGTGGAAGCATCAGAAGGATGTGTTTTTGAGTGCCATATCCAGTGGAGCTGACTCTCCCAACAGCAAAAATGGCAACATGCCCATGTCGGGCAACACTGGAGAGAATTTCAGAAAGAACCTCACAGATGTCATCAAAAAGTCCATGGTGGACCATACGAGCGCTTTCTCCACAGAGGAACTGCCACCTCCTGTCCACTTATCAAAGCCAGGGGAACACATGGATGTGTATGTGCCTGTGGCCTGTCACCCAGGCTACTTCGTCATCCAGCCTTGGCAGGAGATACATAAGTTGGAAGTTCTGATGGAAGAGATGATTCTATATTACAGCGTGTCTGAAGAGCGCCACATAGCAGTGGAGAAAGACCAAGTGTATGCTGCAAAAGTGGAAAATAAGTGGCACAGGGTGCTTTTAAAAGGAATCCTGACCAATGGACTGGTATCTGTGTATGAGCTGGATTATGGCAAACACGAATTAGTCAACATAAGAAAAGTACAGCCCCTAGTGGACATGTTCCGAAAGCTGCCCTTCCAAGCAGTCACAGCTCAACTTGCAGGAGTGAAGTGCAACCAGTGGTCTGAGGAGGCTTCTATGGTGTTTCGAAATCATGTGGAGAAGAAACCTCTGGTGGCACTGGTGCAGACAGTCATTGAAAATGCTAACCCTTGGGACCGGAAAGTAGTGGTCTACTTAGTGGACACATCGTTGCCAGACACCGATACCTGGATTCATGATTTTATGTCAGAGTATCTGATAGAGCTTTCAAAAGTTAATTAA

Back to List