Details for gene: AGK


Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule.


Symbol
AGK
Name
acylglycerol kinase
Entrez ID
55750
Ensembl ID
ENSG00000006530    (more details)
KEGG ID
hsa:55750    (more details)
OMIM ID
610345
Uniprot ID
Q53H12  
GO ID
hsa:55750    (more details)
Chromosome
7
Strand
1
Start
141551278
End
141655244
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-515-5p (RPM: 0.18) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-582-5p (RPM: 8.1398) / hsa-miR-4510 (RPM: 7.6222) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-1226-5p (RPM: 0.426) / hsa-miR-3126-5p (RPM: 0.6218) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-3179 (RPM: 0.0296) / hsa-miR-3682-3p (RPM: 0.0134) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-526b-5p (RPM: 0.2456) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-5695 (RPM: 0.4768) / hsa-miR-519d-5p (RPM: 0.0022) / hsa-miR-6130 (RPM: 0.0054) / hsa-miR-6129 (RPM: 0.0292) / hsa-miR-3691-3p (RPM: 0.0432) / hsa-miR-6834-5p (RPM: 0.0274) / hsa-miR-6875-5p (RPM: 0.643) / hsa-miR-6734-5p (RPM: 0.3692) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Metabolic pathways / Glycerolipid metabolism / Disease / Metabolism / Glycerophospholipid biosynthesis / Phospholipid metabolism / Metabolism of lipids / Diseases of signal transduction by growth factor receptors and second messengers / Signaling by BRAF and RAF fusions / Oncogenic MAPK signaling /
Sequence
ATGACGGTGTTCTTTAAAACGCTTCGAAATCACTGGAAGAAAACTACAGCTGGGCTCTGCCTGCTGACCTGGGGAGGCCATTGGCTCTATGGAAAACACTGTGATAACCTCCTAAGGAGAGCAGCCTGTCAAGAAGCTCAGGTGTTTGGCAATCAACTCATTCCTCCCAATGCACAAGTGAAGAAGGCCACTGTTTTTCTCAATCCTGCAGCTTGCAAAGGAAAAGCCAGGACTCTATTTGAAAAAAATGCTGCCCCGATTTTACATTTATCTGGCATGGATGTGACTATTGTTAAGACAGATTATGAGGGACAAGCCAAGAAACTCCTGGAACTGATGGAAAACACGGATGTGATCATTGTTGCAGGAGGAGATGGGACACTGCAGGAGGTTGTTACTGGTGTTCTTCGACGAACAGATGAGGCTACCTTCAGTAAGATTCCCATTGGATTTATCCCACTGGGAGAGACCAGTAGTTTGAGTCATACCCTCTTTGCCGAAAGTGGAAACAAAGTCCAACATATTACTGATGCCACACTTGCCATTGTGAAAGGAGAGACAGTTCCACTTGATGTCTTGCAGATCAAGGGTGAAAAGGAACAGCCTGTATTTGCAATGACCGGCCTTCGATGGGGATCTTTCAGAGATGCTGGCGTCAAAGTTAGCAAGTACTGGTATCTTGGGCCTCTAAAAATCAAAGCAGCCCACTTTTTCAGCACTCTTAAGGAGTGGCCTCAGACTCATCAAGCCTCTATCTCATACACGGGACCTACAGAGAGACCTCCCAATGAACCAGAGGAGACCCCTGTACAAAGGCCTTCTTTGTACAGGAGAATATTACGAAGGCTTGCGTCCTACTGGGCACAACCACAGGATGCCCTTTCCCAAGAGGTGAGCCCGGAGGTCTGGAAAGATGTGCAGCTGTCCACCATTGAACTGTCCATCACAACACGGAATAATCAGCTTGACCCGACAAGCAAAGAAGATTTTCTGAATATCTGCATTGAACCTGACACCATCAGCAAAGGAGACTTTATAACTATAGGAAGTCGAAAGGTGAGAAACCCCAAGCTGCACGTGGAGGGCACGGAGTGTCTCCAAGCCAGCCAGTGCACTTTGCTTATCCCGGAGGGAGCAGGGGGCTCTTTTAGCATTGACAGTGAGGAGTATGAAGCGATGCCTGTGGAGGTGAAACTGCTCCCCAGGAAGCTGCAGTTCTTCTGTGATCCTAGGAAGAGAGAACAGATGCTCACAAGCCCCACCCAGTGA

Back to List