Details for gene: CRYGB


The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image.


Symbol
CRYGB
Name
crystallin gamma B
Entrez ID
1419
Ensembl ID
ENSG00000182187    (more details)
KEGG ID
hsa:1419    (more details)
OMIM ID
123670
Uniprot ID
P07316  
GO ID
hsa:1419    (more details)
Chromosome
2
Strand
-1
Start
208142573
End
208146158
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-941 (RPM: 399.631) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGGAAAGATCACCTTCTACGAGGACAGGGCCTTCCAGGGCCGCAGCTACGAATGCACCACTGACTGCCCCAACCTACAACCCTATTTCAGCCGCTGCAACTCCATCAGGGTGGAGAGCGGCTGCTGGATGATCTATGAGCGCCCCAACTACCAGGGCCACCAGTACTTCCTGCGGCGTGGGGAGTACCCTGACTACCAGCAATGGATGGGCCTCAGCGACTCCATCCGCTCCTGCTGCCTCATCCCCCCGCACTCTGGCGCTTACAGAATGAAGATCTACGACAGAGATGAATTGAGGGGACAAATGTCAGAGCTCACAGACGACTGTATCTCTGTTCAGGACCGCTTCCACCTCACTGAAATTCACTCCCTCAATGTGCTGGAGGGCAGCTGGATCCTCTATGAGATGCCCAACTACAGGGGGAGGCAGTATCTGCTGAGGCCGGGGGAGTACAGGAGGTTTCTTGATTGGGGGGCTCCAAATGCCAAAGTTGGCTCTCTTAGACGAGTCATGGATTTGTACTGA

Back to List