Details for gene: NHS


All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.


Symbol
NHS
Name
NHS actin remodeling regulator
Entrez ID
4810
Ensembl ID
ENSG00000188158    (more details)
KEGG ID
hsa:4810    (more details)
OMIM ID
300457
Uniprot ID
Q6T4R5  
GO ID
hsa:4810    (more details)
Chromosome
X
Strand
1
Start
17375200
End
17735994
miRNA Interactions
hsa-miR-1277-5p (RPM: 3.0234) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-3163 (RPM: 0.012) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-578 (RPM: 0.0174) / hsa-miR-548t-5p (RPM: 0.0066) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-671-3p (RPM: 91.9442) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-607 (RPM: 0.001) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-3909 (RPM: 20.8842) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-548u (RPM: 0.0946) / hsa-miR-4760-3p (RPM: 0.0036) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-548n (RPM: 0.0924) / hsa-miR-580-3p (RPM: 0.1496) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-548ar-5p (RPM: 0.0164) / hsa-miR-548ap-5p (RPM: 0.0048) / hsa-miR-548au-5p (RPM: 0.1902) / hsa-miR-548as-5p (RPM: 0.0316) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548b-5p (RPM: 0.2842) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-548ab (RPM: 0.3238) / hsa-miR-548y (RPM: 0.046) / hsa-miR-548h-5p (RPM: 0.3692) / hsa-miR-4690-5p (RPM: 0.0154) / hsa-miR-4470 (RPM: 0.0068) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-548ak (RPM: 0.0892) / hsa-miR-548aq-5p (RPM: 0.0114) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-382-5p (RPM: 9.8234) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-4477a (RPM: 0.0024) / hsa-miR-3159 (RPM: 0.2288) / hsa-miR-5011-3p (RPM: 0.0008) / hsa-miR-6510-5p (RPM: 0.0546) / hsa-miR-548az-5p (RPM: 0.4836) / hsa-miR-153-5p (RPM: 0.2042) / hsa-miR-6852-3p (RPM: 0.0022) / hsa-miR-495-5p (RPM: 0.0916) / hsa-miR-548ay-5p (RPM: 0.357) / hsa-miR-548bb-5p (RPM: 0.0048) / hsa-miR-548ad-5p (RPM: 0.3028) / hsa-miR-548ae-5p (RPM: 1.1262) / hsa-miR-580-5p (RPM: 0.002) / hsa-miR-889-5p (RPM: 0.1338) / hsa-miR-6792-5p (RPM: 0.0042) / hsa-miR-6818-5p (RPM: 0.2914) / hsa-miR-6797-3p (RPM: 0.1958) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
RAC1 GTPase cycle / RAC2 GTPase cycle / RAC3 GTPase cycle /
Sequence
ATGCCTTTCGCCAAGCGGATCGTGGAGCCGCAATGGCTGTGCAGGCAGCGGCGCCCTGCGCCCGGCCCAGCAGTGGACGCGAGCGGAGGCAGCGCTGAGCCGCCGCCGCCCTTGCAGCCGCCGGGCCGGAGGGACCTGGACGAGGTCGAGGCGCCAGGGCCAGAGGAGCCAGCCCGCGCCGTCCCTGCACCTTCAGGGCTGCCACCGCCGCCGCCGCCACTGCCCGCGCCGGCCGACCAGACTCAGCCGCCGCACGGAGAGGCGTCCGTGGCTGGCGAGGAGAGCACGGCGGGGATCCCGGAGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCGGCGGCCGTGCTGCTCATGCTGGACCTATGCGCGGTCAGCAACGCCGCTCTGGCCCGTGTCCTCCGGCAGCTCTCGGACGTGGCCCGGCACGCTTGCAGCCTCTTCCAGGAGCTCGAGAGCGACATCCAGCTCACCCACCGCCGCGTCTGGGCGCTGCAGGGCAAGCTCGGCGGCGTGCAGCGCGTCCTCAGCACGCTTGACCCTAAGCAGGAGGCAGTGCCCGTCTCCAACCTGGACATAGAGAGTAAGCTGAGTGTGTACTACCGCGCCCCGTGGCACCAGCAGCGCAACATCTTCCTCCCAGCCACAAGGCCACCCTGCGTGGAGGAGCTGCACCGCCACGCCCGGCAGAGCCTGCAAGCCCTGCGCAGAGAACACCGGAGCCGGAGCGATCGCCGAGAGCAAAGAGCAGCTGCCCCCCTTTCCATTGCAGCTCCTCCACTGCCAGCCTACCCTCCAGCTCACAGCCAGAGGAGGCGTGAGTTTAAGGACCGTCACTTTTTAACGTTTAACAGCACCCGTTCGCCCTCCCCCACTGAATGTTGCCACATGACCCCGTGGAGTAGAAAGTCCCATCCCCCAGAGGATGAAGATACAGATGTCATGTTAGGGCAGAGGCCGAAAAACCCAATACACAATATCCCTTCCACACTGGACAAGCAGACCAACTGGAGCAAAGCACTACCTCTCCCGACGCCAGAGGAGAAGATGAAACAAGATGCCCAAGTGATTTCTTCTTGCATTATTCCCATCAATGTTACTGGAGTTGGCTTTGACAGAGAGGCTAGTATACGCTGCTCTCTGGTTCATTCACAATCGGTACTACAGCGGAGACGAAAATTGAGGAGGAGGAAAACCATCTCGGGTATCCCCAGAAGAGTTCAACAAGAAATAGATTCTGATGAATCACCAGTGGCCAGGGAAAGGAATGTGATTGTGCACACAAACCCAGACCCCTCCAACACTGTCAATAGGATATCCGGAACCAGGGACTCTGAGTGCCAAACCGAGGATATTCTGATTGCTGCCCCATCCAGAAGGAGAATCAGAGCTCAAAGGGGTCAAAGCATTGCAGCTTCCCTTTCTCATTCTGCTGGCAACATTTCTGCCCTAGCAGACAAAGGTGACACCATGTTTACTCCTGCAGTGAGCAGCCGCACAAGATCTCGGAGCCTTCCCCGGGAAGGTAATAGAGGTGGGGATGCTGAGCCCAAAGTTGGCGCTAAACCCTCAGCATATGAAGAGGGAGAGTCTTTTGTGGGTGACCATGAAAGAACCCCTAATGATTTCAGTGAGGCTCCAAGCAGCCCGAGTGCCCAGGACCACCAGCCTACTTTGGGCCTGGCCTGCTCTCAACATCTTCACAGCCCCCAGCACAAATTAAGTGAGAGGGGAAGGTCACGTCTGTCCCGAATGGCTGCTGACTCTGGCAGCTGTGACATCTCCTCCAACTCAGACACGTTTGGGAGCCCCATCCACTGCATCTCCACGGCTGGCGTCCTCCTTAGCAGCCACATGGACCAGAAAGATGACCACCAGTCATCCAGTGGCAACTGGAGTGGGAGCAGCTCCACGTGCCCCTCGCAGACCTCAGAAACCATCCCTCCTGCAGCTTCTCCTCCACTCACTGGCTCTTCACACTGTGACTCGGAGTTGTCACTAAACACAGCCCCTCATGCCAATGAGGATGCCAGTGTTTTCGTGACAGAGCAATACAATGACCACTTGGATAAAGTGAGAGGCCATCGGGCAAACTCCTTTACCTCCACTGTTGCAGACCTGCTGGATGATCCCAACAACAGCAACACAAGTGACAGTGAGTGGAATTACCTACACCACCACCATGATGCCTCCTGCCGCCAGGATTTTAGTCCTGAGCGTCCCAAGGCAGACAGCCTGGGCTGCCCAAGCTTCACAAGCATGGCCACTTATGACAGCTTTCTGGAAAAGTCTCCATCAGACAAAGCGGACACTAGCTCTCACTTTTCAGTAGACACGGAAGGATACTATACCTCCATGCACTTTGACTGTGGTCTCAAAGGTAATAAGAGCTATGTCTGTCACTATGCAGCCCTGGGCCCAGAGAATGGCCAGGGTGTAGGGGCTTCCCCTGGTCTTCCAGATTGTGCCTGGCAGGACTACTTAGACCACAAGAGGCAGGGAAGACCAAGCATCTCTTTCAGGAAACCAAAGGCAAAGCCGACCCCACCTAAACGTAGCTCATCATTGAGGAAGTCTGATGGAAACGCAGATATTTCTGAGAAGAAAGAACCAAAGATAAGCAGTGGTCAGCACCTGCCTCACAGTTCCAGGGAAATGAAGCTGCCTCTTGATTTCGCCAACACGCCTTCTCGAATGGAAAACGCCAATCTTCCCACCAAGCAGGAACCTTCTTGGATAAACCAGAGTGAACAAGGCATTAAGGAACCTCAGTTAGATGCTTCGGATATTCCACCATTCAAAGATGAAGTTGCCGAATCCACACACTATGCAGACCTCTGGCTCCTAAATGACTTGAAAACAAATGATCCTTATAGATCTCTATCTAATTCAAGCACCGCTACGGGTACCACAGTCATTGAATGCATCAAATCTCCAGAGAGCTCTGAATCCCAAACATCACAATCAGAATCAAGAGCCACCACCCCATCTCTTCCTTCTGTTGACAATGAGTTTAAACTGGCTTCACCAGAAAAGCTGGCTGGCTTGGCATCTCCATCAAGTGGCTATTCAAGCCAGTCTGAAACGCCAACATCCTCTTTCCCTACAGCTTTCTTTTCAGGTCCATTGTCTCCCGGAGGTAGCAAAAGAAAACCTAAAGTCCCAGAAAGAAAATCCTCACTACAGCAACCCTCTTTAAAAGATGGAACTATATCACTGAGTAAAGACCTTGAACTTCCAATTATACCTCCTACCCATCTTGATCTAAGTGCTCTTCATAATGTCTTGAACAAACCATTCCACCACCGTCATCCACTGCATGTTTTTACTCATAATAAGCAGAACACAGTAGGAGAAACACTGAGGTCGAATCCTCCACCGTCCCTTGCAATTACACCAACGATCCTGAAATCTGTTAACCTTAGGTCCATCAACAAGTCTGAAGAAGTTAAGCAAAAAGAAGAAAACAATACAGATCTCCCTTATTTAGAGGAAAGCACACTCACAACGGCTGCCTTGTCTCCAAGTAAGATTAGGCCGCATACAGCAAATAAATCAGTATCTCGTCAATACTCCACTGAAGACACCATACTGTCCTTTTTAGACTCTTCTGCAGTTGAGATGGGACCAGATAAACTACATTTAGAAAAAAACTCTACTTTTGATGTGAAGAATCGCTGCGATCCAGAAACCATAACATCAGCTGGTAGCAGTCTTCTAGATTCAAATGTCACAAAAGACCAAGTGCGTACAGAGACTGAGCCTATTCCAGAAAACACGCCAACCAAAAACTGTGCTTTTCCCACAGAAGGATTTCAGAGGGTCTCTGCTGCCCGCCCAAATGATTTGGATGGTAAAATAATACAATATGGACCTGGTCCAGACGAAACTCTAGAACAGGTACAGAAGGCACCCTCTGCAGGTCTGGAGGAAGTTGCACAACCTGAATCTGTGGATGTAATCACATCTCAGTCAGACTCACCAACTAGAGCAACAGATGTAAGCAATCAATTTAAGCATCAATTTGTTATGAGCCGCCACCATGACAAAGTGCCTGGTACTATCAGCTATGAATCGGAGATAACATCTGTAAATTCATTCCCTGAAAAATGTTCCAAGCAGGAAAATATTGCTTCAGGTATTTCAGCCAAAAGTGCCTCTGATAACAGCAAAGCAGAGGAGACCCAAGGAAATGTGGATGAGGCTTCATTGAAAGAATCATCACCGAGTGATGACTCCATCATTTCACCACTTAGTGAAGACTCCCAAGCTGAAGCAGAGGGTGTGTTCGTGTCTCCAAACAAACCTCGAACAACTGAGGATTTATTTGCAGTCATTCACAGATCCAAGAGGAAAGTACTTGGAAGAAAAGATTCCGGGGACATGTCTGTTCGAAGCAAATCGAGAGCTCCCCTCAGCAGTAGCAGCAGCAGCGCCAGTTCCATCACTTCACCCAGCAGTAATGTGACAACCCCCAACAGCCAGAGGTCTCCTGGTCTCATATACCGAAATGCCAAAAAGTCCAACACATCCAATGAAGAGTTTAAGCTGTTACTGCTCAAGAAAGGCAGTCGCTCAGATTCTAGTTACCGCATGTCTGCCACTGAGATCCTGAAGAGCCCCATACTGCCCAAACCTCCTGGGGAGCTCACAGCAGAGTCCCCTCAGAGCACCGATGATGCCCATCAGGGGTCACAAGGGGCTGAGGCATTGTCCCCACTCTCTCCATGCTCCCCACGAGTTAATGCAGAAGGCTTTTCCTCGAAGAGCTTTGCCACCTCAGCATCAGCAAGGGTTGGACGTTCTCGGGCCCCTCCTGCAGCCAGCAGCAGCCGCTACAGTGTCCGCTGCCGGCTGTACAATACGCCCATGCAGGCAATCTCCGAGGGAGAGACGGAAAATTCTGACGGGAGCCCACATGACGACCGTTCCTCCCAGAGTTCAACATAG

Back to List