Details for gene: UNC45B


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
UNC45B
Name
unc-45 myosin chaperone B
Entrez ID
146862
Ensembl ID
ENSG00000141161    (more details)
KEGG ID
hsa:146862    (more details)
OMIM ID
611220
Uniprot ID
Q8IWX7  
GO ID
hsa:146862    (more details)
Chromosome
17
Strand
1
Start
35147817
End
35189345
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-515-5p (RPM: 0.18) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-4668-5p (RPM: 0.092) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-5695 (RPM: 0.4768) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-519d-5p (RPM: 0.0022) / hsa-miR-6895-3p (RPM: 0.15) / hsa-miR-6845-3p (RPM: 0.017) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Sequence
ATGGCAGAGGTGGAAGCGGTACAGCTGAAGGAGGAAGGAAACCGGCATTTCCAGCTCCAGGACTACAAGGCCGCCACAAATAGCTACAGCCAGGCCCTGAAGCTGACCAAGGACAAGGCCCTGCTGGCCACGCTTTATCGGAACCGGGCAGCCTGTGGCCTGAAAACGGAGAGCTACGTCCAGGCAGCTTCAGATGCCTCCAGAGCCATCGACATCAACTCCTCGGACATCAAGGCTCTGTATCGGCGATGCCAGGCACTGGAGCACCTGGGGAAGCTGGACCAGGCCTTCAAAGACGTGCAGCGTTGTGCCACCCTCGAGCCACGGAACCAGAACTTCCAGGAGATGCTGAGGAGACTCAACACCAGCATTCAGGAGAAGCTCCGAGTGCAGTTCTCCACAGACTCGAGGGTACAGAAGATGTTTGAGATCCTCTTGGATGAAAACAGTGAGGCTGATAAGCGGGAAAAGGCTGCCAACAATCTCATTGTCCTAGGCCGTGAGGAAGCAGGGGCTGAGAAGATCTTCCAGAACAATGGAGTAGCCTTGCTACTGCAGCTTCTGGACACTAAGAAGCCTGAGCTGGTGCTGGCTGCAGTGCGGACCCTGTCGGGCATGTGCAGCGGCCACCAAGCCAGAGCCACAGTGATTCTGCATGCAGTGCGGATAGACCGAATCTGTAGCCTCATGGCCGTGGAGAATGAGGAGATGTCTCTGGCTGTCTGCAACCTGCTCCAAGCCATCATTGACTCCTTGTCTGGGGAGGACAAGCGGGAGCATCGAGGGAAGGAGGAGGCCCTGGTTCTAGACACCAAGAAGGACCTGAAGCAGATCACCAGCCACCTGCTGGACATGCTAGTCAGCAAGAAGGTGTCTGGCCAGGGCAGGGATCAGGCGCTGAACCTGCTCAATAAGAATGTTCCCAGGAAGGACCTTGCCATTCATGACAACTCACGTACCATCTATGTGGTGGATAATGGTCTGAGGAAGATCCTGAAGGTTGTGGGGCAGGTTCCAGATCTGCCATCCTGCCTGCCCCTGACTGACAACACCCGCATGCTGGCCTCTATCCTCATCAACAAGCTCTATGATGACCTGCGCTGTGACCCGGAGCGCGATCACTTCCGCAAGATCTGTGAGGAATATATCACGGGCAAGTTTGACCCCCAGGACATGGACAAGAACTTGAATGCCATCCAGACAGTGTCAGGGATCCTGCAGGGCCCCTTTGACCTGGGCAACCAGCTGCTGGGACTGAAAGGTGTGATGGAGATGATGGTGGCACTATGTGGCTCAGAGCGCGAGACGGACCAGCTGGTGGCCGTGGAGGCCCTCATCCATGCCTCCACGAAGCTCAGCCGCGCCACCTTCATCATCACCAATGGAGTGTCACTGCTCAAACAGATCTACAAGACCACCAAAAATGAGAAGATCAAGATCCGCACACTGGTGGGACTCTGTAAGCTCGGCTCTGCAGGTGGCACAGACTACGGTCTCAGGCAGTTTGCGGAAGGGTCGACAGAAAAACTGGCCAAACAGTGTCGCAAGTGGCTGTGCAATATGTCCATAGACACTCGGACCCGACGCTGGGCAGTGGAGGGCCTGGCCTACCTCACGCTGGACGCTGATGTGAAGGACGACTTTGTCCAGGACGTCCCTGCCCTGCAGGCCATGTTTGAGCTGGCCAAGGCAGGTACCAGTGACAAGACCATCCTGTACTCGGTGGCCACCACCCTGGTGAACTGCACCAACAGCTACGATGTCAAGGAGGTCATCCCAGAGCTTGTCCAGCTCGCCAAGTTCTCCAAGCAGCATGTGCCCGAGGAACACCCCAAGGACAAGAAGGACTTTATAGACATGCGGGTGAAGCGGCTTCTGAAGGCGGGTGTCATCTCTGCCCTGGCTTGCATGGTGAAAGCAGATAGTGCCATCCTCACTGACCAGACCAAGGAGCTGCTGGCCAGGGTATTCCTGGCACTGTGTGACAACCCAAAGGACCGAGGCACCATTGTGGCTCAAGGTGGTGGCAAGGCCCTGATTCCCCTGGCTTTGGAGGGCACAGATGTGGGCAAGGTGAAGGCAGCCCACGCTCTAGCAAAGATCGCTGCTGTCTCCAATCCGGACATTGCTTTTCCTGGGGAGCGGGTGTATGAGGTGGTGCGGCCCCTTGTAAGACTCTTGGACACACAGAGGGATGGGCTTCAGAACTATGAGGCTCTCCTAGGCCTCACCAACCTGTCTGGGCGGAGTGACAAACTCCGGCAGAAGATCTTTAAGGAGAGGGCCTTGCCAGACATCGAGAACTACATGTTTGAGAATCATGATCAGCTGCGGCAGGCGGCCACCGAGTGCATGTGCAACATGGTGCTCCACAAGGAGGTACAGGAAAGGTTCTTGGCTGACGGGAATGACCGGCTGAAGCTGGTGGTGCTGCTCTGCGGGGAGGATGATGATAAGGTGCAGAATGCGGCTGCAGGGGCTCTGGCCATGCTGACAGCAGCACACAAGAAACTGTGCCTCAAGATGACTCAAGTGACAACCCAGTGGTTGGAGATCCTCCAGCGGCTTTGCCTGCACGACCAGCTGTCTGTCCAACACCGGGGCCTGGTCATTGCCTACAACCTACTGGCAGCCGATGCTGAGCTGGCCAAGAAGCTGGTGGAGAGTGAGCTGCTGGAGATCCTGACTGTGGTGGGCAAACAGGAGCCAGATGAGAAGAAGGCAGAAGTGGTTCAGACAGCCCGAGAATGTCTCATCAAGTGCATGGATTATGGTTTCATTAAACCAGTGTCTTAG

Back to List