Details for gene: LSS


Catalysis of the transfer of a functional group from one position to another within a single molecule.


Symbol
LSS
Name
lanosterol synthase
Entrez ID
4047
Ensembl ID
ENSG00000160285    (more details)
KEGG ID
hsa:4047    (more details)
OMIM ID
600909
Uniprot ID
P48449  
GO ID
hsa:4047    (more details)
Chromosome
21
Strand
-1
Start
46188141
End
46228824
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-2110 (RPM: 10.1142) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-129-1-3p (RPM: 8.647) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-199b-5p (RPM: 234.7942) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-3157-5p (RPM: 0.3264) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-940 (RPM: 4.614) / hsa-miR-556-5p (RPM: 0.386) / hsa-miR-4286 (RPM: 45.599) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-140-5p (RPM: 21.3322) / hsa-miR-760 (RPM: 7.6702) / hsa-miR-1227-3p (RPM: 0.046) / hsa-miR-194-3p (RPM: 0.633) / hsa-miR-941 (RPM: 399.631) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-99b-5p (RPM: 14318.7458) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Metabolic pathways / Steroid biosynthesis / Metabolism / Metabolism of lipids / Regulation of cholesterol biosynthesis by SREBP (SREBF) / Cholesterol biosynthesis / Activation of gene expression by SREBF (SREBP) / Metabolism of steroids /
Sequence
ATGACGGAGGGCACGTGTCTGCGGCGCCGAGGGGGCCCCTACAAGACCGAGCCCGCCACCGACCTCGGCCGCTGGCGACTCAACTGCGAGAGGGGCCGGCAGACGTGGACCTACCTGCAGGACGAGCGCGCCGGCCGCGAGCAGACCGGCCTGGAAGCCTACGCCCTGGGGCTGGACACCAAGAATTACTTTAAGGACTTGCCCAAAGCCCACACCGCCTTTGAGGGGGCTCTGAACGGGATGACATTTTACGTGGGGCTGCAGGCTGAGGATGGGCACTGGACGGGTGATTATGGTGGCCCACTTTTCCTCCTGCCAGGCCTCCTGATCACTTGCCACGTGGCACGCATCCCTCTGCCAGCCGGATACAGAGAAGAGATTGTGCGGTACCTGCGGTCAGTGCAGCTCCCTGACGGTGGCTGGGGCCTGCACATTGAGGATAAGTCCACCGTGTTTGGGACTGCGCTCAACTATGTGTCTCTCAGAATTCTGGGTGTTGGGCCTGACGATCCTGACCTGGTACGAGCCCGGAACATTCTTCACAAGAAAGGTGGTGCTGTGGCCATCCCCTCCTGGGGGAAGTTCTGGCTGGCTGTCCTGAATGTTTACAGCTGGGAAGGCCTCAATACCCTGTTCCCAGAGATGTGGCTGTTTCCTGACTGGGCACCGGCACACCCCTCCACACTCTGGTGCCACTGCCGGCAGGTGTACCTGCCCATGAGCTACTGCTACGCCGTTCGGCTGAGTGCCGCGGAAGACCCGCTGGTCCAGAGCCTCCGCCAGGAGCTCTATGTGGAGGACTTCGCCAGCATTGACTGGCTGGCGCAGAGGAACAACGTGGCCCCCGACGAGCTGTACACGCCGCACAGCTGGCTGCTCCGCGTGGTATATGCGCTCCTCAACCTGTATGAGCACCACCACAGTGCCCACCTGCGGCAGCGGGCCGTGCAGAAGCTGTATGAACACATTGTGGCCGACGACCGATTCACCAAGAGCATCAGCATCGGCCCGATCTCGAAAACCATCAACATGCTTGTGCGCTGGTATGTGGACGGGCCCGCCTCCACTGCCTTCCAGGAGCATGTCTCCAGAATCCCGGACTATCTCTGGATGGGCCTTGACGGCATGAAAATGCAGGGCACCAACGGCTCACAGATCTGGGACACCGCATTCGCCATCCAGGCTCTGCTTGAGGCGGGCGGGCACCACAGGCCCGAGTTTTCGTCCTGCCTGCAGAAGGCTCATGAGTTCCTGAGGCTCTCACAGGTCCCAGATAACCCTCCCGACTACCAGAAGTACTACCGCCAGATGCGCAAGGGTGGCTTCTCCTTCAGTACGCTGGACTGCGGCTGGATCGTTTCTGACTGCACGGCTGAGGCCTTGAAGGCTGTGCTGCTCCTGCAGGAGAAGTGTCCCCATGTCACCGAGCACATCCCCAGAGAACGGCTCTGCGATGCTGTGGCTGTGCTGCTGAACATGAGAAATCCAGATGGAGGGTTCGCCACCTATGAGACCAAGCGTGGGGGGCACTTGCTGGAGCTGCTGAACCCCTCGGAGGTCTTCGGGGACATCATGATTGACTACACCTATGTGGAGTGCACCTCAGCCGTGATGCAGGCGCTTAAGTATTTCCACAAGCGTTTCCCGGAGCACAGGGCAGCGGAGATCCGGGAGACCCTCACGCAGGGCTTAGAGTTCTGTCGGCGGCAGCAGAGGGCCGATGGCTCCTGGGAAGGCTCCTGGGGAGTTTGCTTCACCTACGGCACCTGGTTTGGCCTGGAGGCCTTCGCCTGTATGGGGCAGACCTACCGAGATGGGACTGCCTGTGCAGAGGTCTCCCGGGCCTGTGACTTCCTGCTGTCCCGGCAGATGGCAGACGGAGGCTGGGGGGAGGACTTTGAGTCCTGCGAGGAGCGGCGTTATTTGCAGAGTGCCCAGTCCCAGATCCATAACACATGCTGGGCCATGATGGGGCTGATGGCCGTTCGGCATCCTGACATCGAGGCCCAGGAGAGAGGAGTCCGGTGTCTACTTGAGAAACAGCTCCCCAATGGCGACTGGCCGCAGGAAAACATTGCTGGGGTCTTCAACAAGTCCTGTGCCATCTCCTACACGAGCTACAGGAACATCTTCCCCATCTGGGCCCTCGGCCGCTTCTCCCAGCTGTACCCTGAGAGAGCCCTTGCTGGCCACCCCTGA

Back to List