Details for gene: LEMD2


A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the nuclear envelope.


Symbol
LEMD2
Name
LEM domain nuclear envelope protein 2
Entrez ID
221496
Ensembl ID
ENSG00000161904    (more details)
KEGG ID
hsa:221496    (more details)
OMIM ID
616312
Uniprot ID
Q8NC56  
GO ID
hsa:221496    (more details)
Chromosome
6
Strand
-1
Start
33771202
End
33789130
miRNA Interactions
hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-544a (RPM: 0.082) / hsa-miR-5001-3p (RPM: 0.622) / hsa-miR-570-3p (RPM: 0.1902) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-4769-3p (RPM: 0.0098) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-1276 (RPM: 0.9142) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-5008-5p (RPM: 0.0186) / hsa-miR-4690-5p (RPM: 0.0154) / hsa-miR-4727-5p (RPM: 0.006) / hsa-miR-4429 (RPM: 0.0238) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-433-3p (RPM: 9.0888) / hsa-miR-1306-3p (RPM: 0.8504) / hsa-miR-5088-3p (RPM: 0.3748) / hsa-miR-6738-3p (RPM: 0.0212) / hsa-miR-7108-3p (RPM: 0.0616) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Rap1 signaling pathway / Cell Cycle / Mitotic Metaphase and Anaphase / Nuclear Envelope (NE) Reassembly / Mitotic Anaphase / M Phase / Cell Cycle, Mitotic / Sealing of the nuclear envelope (NE) by ESCRT-III / Nuclear Envelope Breakdown / Initiation of Nuclear Envelope (NE) Reformation / Depolymerisation of the Nuclear Lamina / Mitotic Prophase /
Sequence
ATGGCCGGCCTGTCGGACCTGGAACTGCGGCGGGAGCTGCAGGCCCTGGGCTTCCAGCCAGGACCCATCACCGACACCACCCGGGATGTCTACCGCAACAAGCTGCGCCGCCTGCGGGGCGAGGCCCGGCTGCGCGACGAGGAGCGGCTGCGGGAGGAGGCCCGGCCGCGGGGCGAGGAGCGGTTACGGGAAGAGGCCCGGTTACGCGAGGATGCGCCGCTGCGCGCCCGGCCCGCCGCGGCCTCTCCGCGGGCGGAGCCCTGGCTCTCCCAGCCGGCCTCGGGCTCGGCCTACGCGACCCCTGGGGCCTACGGTGATATCCGGCCCTCCGCGGCTTCCTGGGTAGGGAGCCGCGGCCTCGCCTATCCTGCCCGCCCGGCGCAACTCAGGCGCCGCGCCTCGGTCCGGGGCAGCTCCGAGGAGGACGAGGACGCCCGGACGCCCGACAGGGCCACGCAGGGCCCGGGTCTCGCGGCCCGCCGCTGGTGGGCAGCGTCTCCCGCCCCGGCGCGGCTGCCTTCCTCCCTCCTCGGTCCCGACCCGCGCCCGGGCCTGCGGGCGACTCGAGCGGGCCCTGCTGGCGCGGCGAGGGCCCGGCCTGAGGTGGGGCGCCGGCTGGAGCGCTGGCTCTCTCGGCTTCTGCTCTGGGCCAGCCTAGGGCTACTGCTCGTCTTCCTGGGCATCCTTTGGGTGAAGATGGGCAAGCCCTCAGCGCCGCAGGAGGCGGAGGACAACATGAAGTTATTGCCAGTGGACTGTGAGAGAAAAACAGATGAGTTCTGTCAGGCCAAGCAGAAGGCAGCCTTGCTGGAGCTGCTGCATGAACTCTACAATTTCCTGGCCATCCAAGCTGGTAATTTTGAGTGTGGAAATCCAGAGAATCTAAAAAGCAAATGCATTCCTGTTATGGAAGCCCAAGAATATATAGCCAATGTGACCAGCAGCTCCTCCGCCAAGTTTGAAGCCGCACTGACCTGGATACTGAGCAGTAACAAGGACGTGGGCATCTGGTTGAAAGGAGAAGACCAGTCTGAATTGGTGACGACTGTGGACAAGGTGGTCTGCCTGGAATCTGCCCACCCCCGCATGGGTGTTGGCTGCCGCCTGAGCCGGGCCTTGCTCACTGCTGTCACCAACGTGCTCATCTTCTTCTGGTGCTTGGCTTTTTTGTGGGGGCTCCTAATTCTCCTAAAATATCGGTGGCGAAAGTTAGAAGAGGAGGAACAAGCCATGTATGAGATGGTGAAGAAGATTATAGACGTGGTCCAGGACCATTACGTGGACTGGGAGCAGGACATGGAGCGCTATCCATATGTAGGCATCCTGCACGTGCGCGACAGCTTGATCCCTCCACAGAGCCGGAGGCGCATGAAGCGTGTCTGGGACCGAGCTGTGGAGTTCCTGGCCTCCAACGAATCCCGGATCCAGACGGAGTCCCACCGCGTTGCAGGAGAGGACATGCTGGTGTGGAGATGGACTAAGCCCTCTTCCTTCTCTGACTCAGAGCGATAA

Back to List