Details for gene: SLC16A12


Enables the transfer of a substance, usually a specific substance or a group of related substances, from one side of a membrane to the other.


Symbol
SLC16A12
Name
solute carrier family 16 member 12
Entrez ID
387700
Ensembl ID
ENSG00000152779    (more details)
KEGG ID
hsa:387700    (more details)
OMIM ID
611910
Uniprot ID
Q6ZSM3  
GO ID
hsa:387700    (more details)
Chromosome
10
Strand
-1
Start
89430299
End
89556641
miRNA Interactions
hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-517a-3p (RPM: 0.1354) / hsa-miR-450a-5p (RPM: 1.7656) /
Involved Diseases
cataract / age-related cataract / Volkmann cataract /
Involved Pathways
Initiation of Nuclear Envelope (NE) Reformation / Depolymerisation of the Nuclear Lamina / Clearance of Nuclear Envelope Membranes from Chromatin /
Sequence
ATGCCATCAGGAAGTCACTGGACAGCAAACTCTTCCAAGATCATAACTTGGCTGTTGGAGCAACCTGGAAAAGAAGAAAAAAGAAAAACCATGGCAAAAGTAAATAGAGCTCGGTCTACCTCCCCTCCAGATGGAGGCTGGGGCTGGATGATTGTGGCTGGCTGTTTCCTTGTTACCATCTGCACACGGGCAGTCACAAGATGTATCTCAATTTTTTTTGTGGAGTTCCAGACATACTTCACTCAGGATTACGCACAAACGGCATGGATCCATTCCATTGTAGATTGTGTGACCATGCTCTGTGCTCCACTTGGGAGTGTTGTCAGTAACCATTTATCCTGTCAAGTGGGAATCATGCTGGGTGGCTTGCTTGCATCTACTGGACTCATCCTGAGCTCATTTGCCACGAGTCTGAAGCATCTCTACCTCACTCTGGGAGTTCTTACAGGTCTTGGATTTGCACTTTGTTACTCTCCAGCTATTGCCATGGTTGGCAAGTACTTCAGCAGACGGAAAGCCCTTGCTTATGGTATCGCCATGTCAGGAAGTGGCATTGGCACCTTCATCCTGGCTCCTGTGGTTCAGCTCCTTATTGAACAGTTTTCCTGGCGGGGAGCCTTACTCATTCTTGGGGGCTTTGTCTTGAATCTCTGTGTATGTGGTGCCTTGATGAGGCCAATTACTCTTAAAGAGGACCACACAACTCCAGAGCAGAACCATGTGTGTAGAACTCAGAAAGAAGACATTAAGCGGGTGTCTCCCTATTCATCTTTGACCAAAGAATGGGCACAGACTTGCCTCTGTTGCTGTTTGCAGCAAGAGTACAGTTTTTTACTCATGTCAGACTTTGTTGTGTTAGCCGTCTCCGTTCTGTTTATGGCTTATGGCTGCAGCCCTCTCTTTGTGTACTTGGTGCCTTATGCTTTGAGTGTTGGAGTGAGTCATCAGCAAGCTGCTTTTCTTATGTCCATACTTGGAGTGATTGACATTATTGGCAATATCACATTTGGATGGCTGACCGACAGAAGGTGTCTGAAGAATTACCAGTATGTTTGCTACCTCTTTGCCGTGGGAATGGATGGGCTCTGCTATCTCTGCCTCCCAATGCTTCAAAGTCTCCCTCTGCTCGTGCCTTTCTCTTGTACCTTTGGCTACTTTGATGGTGCCTATGTGACTTTGATCCCAGTAGTGACCACAGAGATAGTGGGGACCACCTCTTTGTCATCAGCGCTTGGTGTGGTATACTTCCTTCACGCAGTGCCATACTTGGTGAGCCCACCCATCGCAGGACGGCTGGTAGATACCACCGGCAGCTACACTGCAGCATTCCTCCTCTGTGGATTTTCAATGATATTTAGTTCTGTGTTGCTTGGCTTTGCTAGACTTATAAAGAGAATGAGAAAAACCCAGTTGCAGTTCATTGCCAAAGAATCTGATCCTAAGCTGCAGCTATGGACCAATGGATCAGTGGCTTATTCTGTGGCAAGAGAATTAGATCAGAAACATGGGGAGCCTGTGGCTACAGCAGTGCCTGGCTACAGCCTCACATGA

Back to List