Details for gene: AQP4


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
AQP4
Name
aquaporin 4
Entrez ID
361
Ensembl ID
ENSG00000171885    (more details)
KEGG ID
hsa:361    (more details)
OMIM ID
600308
Uniprot ID
P55087  
GO ID
hsa:361    (more details)
Chromosome
18
Strand
-1
Start
26852043
End
26865771
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-139-5p (RPM: 36.887) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-219a-2-3p (RPM: 0.3508) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-425-5p (RPM: 187.631) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
neuromyelitis optica (NMO) /
Involved Pathways
Bile secretion / Passive transport by Aquaporins / Vasopressin regulates renal water homeostasis via Aquaporins / Vasopressin-regulated water reabsorption /
Sequence
ATGAGTGACAGACCCACAGCAAGGCGGTGGGGTAAGTGTGGACCTTTGTGTACCAGAGAGAACATCATGGTGGCTTTCAAAGGGGTCTGGACTCAAGCTTTCTGGAAAGCAGTCACAGCGGAATTTCTGGCCATGCTTATTTTTGTTCTCCTCAGCCTGGGATCCACCATCAACTGGGGTGGAACAGAAAAGCCTTTACCGGTCGACATGGTTCTCATCTCCCTTTGCTTTGGACTCAGCATTGCAACCATGGTGCAGTGCTTTGGCCATATCAGCGGTGGCCACATCAACCCTGCAGTGACTGTGGCCATGGTGTGCACCAGGAAGATCAGCATCGCCAAGTCTGTCTTCTACATCGCAGCCCAGTGCCTGGGGGCCATCATTGGAGCAGGAATCCTCTATCTGGTCACACCTCCCAGTGTGGTGGGAGGCCTGGGAGTCACCATGGTTCATGGAAATCTTACCGCTGGTCATGGTCTCCTGGTTGAGTTGATAATCACATTTCAATTGGTGTTTACTATCTTTGCCAGCTGTGATTCCAAACGGACTGATGTCACTGGCTCAATAGCTTTAGCAATTGGATTTTCTGTTGCAATTGGACATTTATTTGCAATCAATTATACTGGTGCCAGCATGAATCCCGCCCGATCCTTTGGACCTGCAGTTATCATGGGAAATTGGGAAAACCATTGGATATATTGGGTTGGGCCCATCATAGGAGCTGTCCTCGCTGGTGGCCTTTATGAGTATGTCTTCTGTCCAGATGTTGAATTCAAACGTCGTTTTAAAGAAGCCTTCAGCAAAGCTGCCCAGCAAACAAAAGGAAGCTACATGGAGGTGGAGGACAACAGGAGTCAGGTAGAGACGGATGACCTGATTCTAAAACCTGGAGTGGTGCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGA

Back to List