Details for gene: OPTN


A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways.


Symbol
OPTN
Name
optineurin
Entrez ID
10133
Ensembl ID
ENSG00000123240    (more details)
KEGG ID
hsa:10133    (more details)
OMIM ID
602432
Uniprot ID
Q96CV9  
GO ID
hsa:10133    (more details)
Chromosome
10
Strand
1
Start
13099449
End
13138308
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-1237-3p (RPM: 0.1416) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-4430 (RPM: 0.0026) / hsa-miR-1248 (RPM: 0.4708) / hsa-miR-3135b (RPM: 0.0038) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-3652 (RPM: 0.0324) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-3667-3p (RPM: 0.0008) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-4638-5p (RPM: 0.0318) / hsa-miR-1307-3p (RPM: 130.8454) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-6868-3p (RPM: 0.3062) / hsa-miR-2276-5p (RPM: 0.085) / hsa-miR-6734-3p (RPM: 0.014) / hsa-miR-6879-3p (RPM: 0.0316) / hsa-miR-504-3p (RPM: 0.16) / hsa-miR-6773-3p (RPM: 0.0024) / hsa-miR-500b-3p (RPM: 0.3408) / hsa-miR-6741-3p (RPM: 0.6252) / hsa-miR-215-3p (RPM: 0.0012) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Amyotrophic lateral sclerosis (ALS) / Membrane Trafficking / Vesicle-mediated transport / Cell Cycle / Cell Cycle, Mitotic / Regulation of PLK1 Activity at G2/M Transition / Mitotic G2-G2/M phases / G2/M Transition / TBC/RABGAPs / Rab regulation of trafficking / Pathways of neurodegeneration - multiple diseases / Mitophagy - animal /
Sequence
ATGTCCCATCAACCTCTCAGCTGCCTCACTGAAAAGGAGGACAGCCCCAGTGAAAGCACAGGAAATGGACCCCCCCACCTGGCCCACCCAAACCTGGACACGTTTACCCCGGAGGAGCTGCTGCAGCAGATGAAAGAGCTCCTGACCGAGAACCACCAGCTGAAAGAAGCCATGAAGCTAAATAATCAAGCCATGAAAGGGAGATTTGAGGAGCTTTCGGCCTGGACAGAGAAACAGAAGGAAGAACGCCAGTTTTTTGAGATACAGAGCAAAGAAGCAAAAGAGCGTCTAATGGCCTTGAGTCATGAGAATGAGAAATTGAAGGAAGAGCTTGGAAAACTAAAAGGGAAATCAGAAAGGTCATCTGAGGACCCCACTGATGACTCCAGGCTTCCCAGGGCCGAAGCGGAGCAGGAAAAGGACCAGCTCAGGACCCAGGTGGTGAGGCTACAAGCAGAGAAGGCAGACCTGTTGGGCATCGTGTCTGAACTGCAGCTCAAGCTGAACTCCAGCGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTGACATCTCTGTTTAAGGAGCTTCAAGAGGCTCATACAAAACTCAGCGAAGCTGAGCTAATGAAGAAGAGACTTCAAGAAAAGTGTCAGGCCCTTGAAAGGAAAAATTCTGCAATTCCATCAGAGTTGAATGAAAAGCAAGAGCTTGTTTATACTAACAAAAAGTTAGAGCTACAAGTGGAAAGCATGCTATCAGAAATCAAAATGGAACAGGCTAAAACAGAGGATGAAAAGTCCAAATTAACTGTGCTACAGATGACACACAACAAGCTTCTTCAAGAACATAATAATGCATTGAAAACAATTGAGGAACTAACAAGAAAAGAGTCAGAAAAAGTGGACAGGGCAGTGCTGAAGGAACTGAGTGAAAAACTGGAACTGGCAGAGAAGGCTCTGGCTTCCAAACAGCTGCAAATGGATGAAATGAAGCAAACCATTGCCAAGCAGGAAGAGGACCTGGAAACCATGACCATCCTCAGGGCTCAGATGGAAGTTTACTGTTCTGATTTTCATGCTGAAAGAGCAGCGAGAGAGAAAATTCATGAGGAAAAGGAGCAACTGGCATTGCAGCTGGCAGTTCTGCTGAAAGAGAATGATGCTTTCGAAGACGGAGGCAGGCAGTCCTTGATGGAGATGCAGAGTCGTCATGGGGCGAGAACAAGTGACTCTGACCAGCAGGCTTACCTTGTTCAAAGAGGAGCTGAGGACAGGGACTGGCGGCAACAGCGGAATATTCCGATTCATTCCTGCCCCAAGTGTGGAGAGGTTCTGCCTGACATAGACACGTTACAGATTCACGTGATGGATTGCATCATTTAA

Back to List