Details for gene: ASB10


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
ASB10
Name
ankyrin repeat and SOCS box containing 10
Entrez ID
136371
Ensembl ID
ENSG00000146926    (more details)
KEGG ID
hsa:136371    (more details)
OMIM ID
615054
Uniprot ID
Q8WXI3  
GO ID
hsa:136371    (more details)
Chromosome
7
Strand
-1
Start
151175698
End
151187832
miRNA Interactions
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Immune System / Metabolism of proteins / Post-translational protein modification / Adaptive Immune System / Neddylation / Antigen processing: Ubiquitination & Proteasome degradation / Class I MHC mediated antigen processing & presentation /
Sequence
ATGCTCATGAGTTGGTCTCCAGAAGAGTGCAAGGGGCAGGGAGAGCCCCTCGATGACAGACACCCCCTCTGTGCCAGGCTGGTGGAGAAGCCCAGCAGAGGGTCTGAGGAGCACCTCAAGTCTGGCCCGGGACCCATCGTCACCCGCACAGCCTCAGGACCTGCCCTTGCCTTCTGGCAGGCAGTGCTGGCTGGGGACGTGGGCTGTGTCTCCCGCATCCTCGCGGACTCCAGTACTGGCCTGGCTCCTGATTCCGTCTTTGATACCAGCGACCCAGAGCGATGGAGGGATTTCCGCTTCAACATCCGTGCTCTGAGACTCTGGTCTCTGACATACGAAGAGGAGCTGACCACCCCACTGCATGTGGCAGCCAGCCGTGGCCACACGGAAGTCCTGCGGCTGCTGCTGAGGCGGCGAGCAAGGCCAGACAGTGCCCCTGGGGGCCGCACCGCCCTGCACGAGGCCTGTGCTGCAGGCCACACTGCCTGTGTTCATGTGCTGCTGGTGGCAGGAGCCGACCCCAACATCGCTGACCAGGATGGGAAACGCCCCCTGCATCTCTGCCGGGGGCCTGGCACCCTTGAGTGTGCGGAGCTGCTCCTCAGGTTTGGAGCGAGAGTGGATGGTCGGTCCGAGGAAGAAGAGGAGACCCCTTTGCATGTGGCCGCCCGGCTTGGCCATGTGGAGCTGGCAGATCTGCTTCTAAGACGGGGGGCATGTCCTGATGCCCGCAATGCCGAAGGCTGGACCCCACTGCTGGCTGCCTGTGACGTCCGCTGCCAGTCCATCACCGATGCCGAGGCCACCACCGCCCGCTGCCTGCAGCTGTGCAGCTTGCTGCTTTCAGCTGGAGCAGACGCTGATGCTGCGGACCAGGACAAGCAGCGACCCCTGCACCTGGCCTGCCGCCGTGGCCATGCAGCTGTCGTGGAGCTGCTCCTGTCCTGTGGTGTCAGCGCCAACACCATGGACTATGGGGGACACACGCCCCTGCACTGTGCTCTGCAGGGCCCAGCTGCAGCCCTGGCCCAGAGCCCCGAGCACGTGGTTCGGGCTCTGCTCAACCATGGCGCCGTCCGTGTCTGGCCAGGGGCCCTCCCCAAGGTGCTGGAGCGCTGGAGCACGTGCCCTCGGACCATCGAGGTCCTGATGAACACCTACAGTGTTGTGCAGCTTCCCGAGGAGGCCGTCGGCCTGGTGACTCCTGAAACTCTGCAGAAACATCAGCGTTTCTACTCCTCCCTCTTCGCCTTGGTGAGGCAGCCCAGGTCGCTGCAGCATTTGAGCCGCTGTGCGCTCCGCTCCCACCTGGAGGGCAGCCTGCCCCAAGCGCTGCCCCGCCTCCCCCTGCCACCGCGCCTGCTCCGCTACCTGCAGCTGGATTTTGAGGGCGTGCTCTACTAG

Back to List