Details for gene: WDR36


This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG).


Symbol
WDR36
Name
WD repeat domain 36
Entrez ID
134430
Ensembl ID
ENSG00000134987    (more details)
KEGG ID
hsa:134430    (more details)
OMIM ID
609669
Uniprot ID
Q8NI36  
GO ID
hsa:134430    (more details)
Chromosome
5
Strand
1
Start
111092321
End
111130502
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-4326 (RPM: 2.7166) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-579-3p (RPM: 0.0084) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-664b-3p (RPM: 4.7274) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-5010-3p (RPM: 1.8422) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-509-3p (RPM: 31.2006) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-148b-5p (RPM: 20.6792) / hsa-miR-885-5p (RPM: 171.0098) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-1910-5p (RPM: 8.4774) / hsa-miR-627-5p (RPM: 0.771) / hsa-miR-760 (RPM: 7.6702) / hsa-miR-660-5p (RPM: 107.579) / hsa-miR-520h (RPM: 0.0012) / hsa-miR-522-5p (RPM: 0.0018) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Ribosome biogenesis in eukaryotes / Metabolism of RNA / rRNA modification in the nucleus and cytosol / Major pathway of rRNA processing in the nucleolus and cytosol / rRNA processing / rRNA processing in the nucleus and cytosol /
Sequence
ATGGAACGGGCCTCAGAAAGGCGCACGGCCAGCGCGCTTTTTGCGGGGTTCCGGGCCTTGGGACTTTTCAGCAACGACATTCCACACGTGGTGCGGTTCAGCGCGCTCAAGCGCCGGTTCTATGTAACAACCTGCGTGGGCAAGAGTTTCCACACCTATGACGTTCAGAAACTTAGTCTGGTTGCAGTAAGTAATTCTGTTCCACAGGATATCTGCTGTATGGCAGCTGATGGCAGATTAGTCTTTGCTGCTTATGGAAATGTTTTCTCTGCATTTGCCCGTAATAAAGAGATAGTACATACCTTTAAGGGTCATAAGGCAGAAATCCATTTCTTGCAACCCTTTGGAGACCACATTATCTCTGTTGATACTGATGGCATTCTTATTATTTGGCACATATATTCAGAAGAAGAATACCTGCAGTTGACTTTTGATAAATCAGTATTTAAAATTTCTGCAATTTTGCATCCAAGTACCTACTTGAATAAAATACTTCTGGGCAGTGAACAAGGAAGCCTGCAGTTGTGGAATGTAAAATCCAATAAACTTCTATATACATTTCCAGGATGGAAAGTTGGAGTGACAGCTCTTCAGCAGGCACCAGCCGTGGATGTTGTTGCTATTGGTCTTATGTCAGGTCAAGTTATCATTCACAACATTAAATTTAATGAAACATTAATGAAGTTTCGTCAAGACTGGGGACCCATTACTTCAATTTCATTTCGCACAGATGGTCATCCAGTAATGGCAGCTGGAAGCCCATGTGGCCATATTGGACTCTGGGATCTAGAAGACAAAAAATTAATCAACCAAATGAGAAATGCACACTCTACAGCAATTGCCGGACTGACATTTCTCCATAGAGAGCCACTTCTTGTCACAAATGGCGCTGACAATGCTCTTAGGATATGGATATTTGATGGTCCTACAGGTGAAGGCCGACTTTTGAGATTCAGAATGGGTCATAGTGCTCCTCTTACCAATATCAGATATTATGGACAGAATGGACAGCAGATTCTAAGTGCAAGTCAAGATGGAACTCTTCAGTCATTTTCCACGGTACATGAAAAATTCAATAAGAGCTTGGGACATGGATTAATAAATAAAAAGAGAGTTAAACGTAAAGGACTTCAGAATACCATGTCAGTGAGACTTCCACCCATCACAAAGTTTGCAGCAGAGGAAGCTCGTGAAAGTGACTGGGATGGTATCATTGCTTGCCATCAAGGTAAGCTATCTTGCTCAACCTGGAATTATCAGAAATCTACAATAGGCGCTTACTTTCTCAAGCCAAAAGAGTTGAAGAAAGATGACATAACTGCAACAGCAGTGGATATAACTTCTTGTGGAAACTTTGCTGTAATTGGCCTCTCATCAGGAACTGTAGATGTATATAACATGCAGTCTGGCATACATCGAGGAAGTTTTGGCAAGGATCAAGCTCACAAGGGATCTGTTAGAGGTGTCGCAGTGGATGGATTAAACCAGTTGACAGTTACAACTGGTAGTGAAGGATTACTCAAATTCTGGAACTTTAAAAACAAAATTTTAATCCATTCTGTGAGCCTCAGTTCATCTCCAAATATCATGTTGCTACATAGGGACAGTGGCATTCTGGGACTCGCCTTGGATGACTTCTCCATTAGTGTTCTGGACATAGAAACTAGGAAGATTGTCAGAGAGTTTTCTGGACACCAAGGCCAAATAAATGACATGGCTTTTAGTCCTGATGGTCGTTGGTTAATAAGTGCTGCGATGGATTGCTCTATTAGGACTTGGGACCTTCCTTCTGGGTGCCTTATAGACTGCTTTTTGTTGGACTCGGCTCCTCTCAATGTTTCTATGTCTCCTACTGGAGACTTTCTGGCAACTTCCCATGTGGACCACCTTGGAATTTATCTATGGTCCAATATTTCCCTGTATTCAGTTGTTTCATTACGGCCACTTCCTGCAGATTATGTCCCTTCAATAGTCATGCTTCCTGGTACTTGTCAAACCCAAGATGTAGAAGTATCAGAAGAAACAGTAGAACCAAGTGATGAATTGATAGAATATGATTCGCCAGAACAGTTGAATGAGCAATTGGTGACTCTTTCACTTCTTCCTGAATCACGATGGAAAAACCTTCTTAACCTTGATGTTATTAAGAAAAAGAATAAACCAAAGGAACCACCCAAAGTACCCAAATCAGCACCATTTTTCATTCCAACAATTCCTGGCCTTGTACCCAGATATGCTGCACCTGAACAAAATAATGATCCCCAGCAGTCTAAAGTGGTAAATCTTGGAGTTTTGGCTCAAAAATCAGATTTCTGCTTGAAACTTGAAGAAGGACTGGTAAATAATAAGTATGACACTGCTCTCAACCTTCTGAAAGAATCAGGCCCATCAGGAATTGAAACAGAGCTGCGAAGCTTGTCTCCTGATTGTGGTGGGTCCATAGAAGTTATGCAGAGCTTCTTGAAAATGATTGGGATGATGCTGGACAGAAAGCGTGATTTTGAGTTAGCCCAGGCATACCTTGCATTGTTTCTAAAGTTACACCTTAAAATGCTTCCTTCAGAGCCAGTACTCCTAGAAGAAATAACAAATTTGTCATCCCAGGTGGAAGAAAACTGGACCCATTTGCAATCACTCTTCAATCAAAGCATGTGTATTTTAAATTATCTCAAAAGTGCTTTGTTGTAA

Back to List