Details for gene: NTF4


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
NTF4
Name
neurotrophin 4
Entrez ID
4909
Ensembl ID
ENSG00000225950    (more details)
KEGG ID
hsa:4909    (more details)
OMIM ID
162662
Uniprot ID
P34130  
GO ID
hsa:4909    (more details)
Chromosome
19
Strand
-1
Start
49061066
End
49065054
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-31-5p (RPM: 310.1326) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
MAPK signaling pathway / Ras signaling pathway / PI3K-Akt signaling pathway / Neurotrophin signaling pathway / Signal Transduction / Signaling by Receptor Tyrosine Kinases / Signaling by NTRKs / Signaling by NTRK2 (TRKB) / NTF4 activates NTRK2 (TRKB) signaling / Activated NTRK2 signals through RAS / Activated NTRK2 signals through PLCG1 / Activated NTRK2 signals through PI3K / Activated NTRK2 signals through FRS2 and FRS3 /
Sequence
ATGCTCCCTCTCCCCTCATGCTCCCTCCCCATCCTCCTCCTTTTCCTCCTCCCCAGTGTGCCAATTGAGTCCCAACCCCCACCCTCAACATTGCCCCCTTTTCTGGCCCCTGAGTGGGACCTTCTCTCCCCCCGAGTAGTCCTGTCTAGGGGTGCCCCTGCTGGGCCCCCTCTGCTCTTCCTGCTGGAGGCTGGGGCCTTTCGGGAGTCAGCAGGTGCCCCGGCCAACCGCAGCCGGCGTGGGGTGAGCGAAACTGCACCAGCGAGTCGTCGGGGTGAGCTGGCTGTGTGCGATGCAGTCAGTGGCTGGGTGACAGACCGCCGGACCGCTGTGGACTTGCGTGGGCGCGAGGTGGAGGTGTTGGGCGAGGTGCCTGCAGCTGGCGGCAGTCCCCTCCGCCAGTACTTCTTTGAAACCCGCTGCAAGGCTGATAACGCTGAGGAAGGTGGCCCGGGGGCAGGTGGAGGGGGCTGCCGGGGAGTGGACAGGAGGCACTGGGTATCTGAGTGCAAGGCCAAGCAGTCCTATGTGCGGGCATTGACCGCTGATGCCCAGGGCCGTGTGGGCTGGCGATGGATTCGAATTGACACTGCCTGCGTCTGCACACTCCTCAGCCGGACTGGCCGGGCCTGA

Back to List