Details for gene: LTBP2


Interacting selectively and non-covalently with calcium ions (Ca2+).


Symbol
LTBP2
Name
latent transforming growth factor beta binding protein 2
Entrez ID
4053
Ensembl ID
ENSG00000119681    (more details)
KEGG ID
hsa:4053    (more details)
OMIM ID
602091
Uniprot ID
Q14767  
GO ID
hsa:4053    (more details)
Chromosome
14
Strand
-1
Start
74498183
End
74612378
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-4520-3p (RPM: 0.6134) / hsa-miR-3922-5p (RPM: 0.0154) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-150-5p (RPM: 64.1654) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-3190-5p (RPM: 0.0008) / hsa-miR-3138 (RPM: 0.07) / hsa-miR-190a-5p (RPM: 14.2908) / hsa-miR-1225-3p (RPM: 0.001) / hsa-miR-4753-5p (RPM: 0.097) / hsa-miR-3940-3p (RPM: 1.3404) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-1233-3p (RPM: 0.4168) / hsa-miR-4435 (RPM: 1.1176) / hsa-miR-4755-3p (RPM: 0.099) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-2116-3p (RPM: 3.873) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-532-3p (RPM: 21.9476) / hsa-miR-4708-3p (RPM: 0.357) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-134-5p (RPM: 29.8712) / hsa-miR-3165 (RPM: 0.0022) / hsa-miR-4423-3p (RPM: 0.0508) / hsa-miR-3622a-5p (RPM: 0.92) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-6806-5p (RPM: 0.0008) / hsa-miR-7113-5p (RPM: 0.1612) / hsa-miR-6754-5p (RPM: 0.0514) / hsa-miR-6730-5p (RPM: 0.871) / hsa-miR-6850-3p (RPM: 0.05) /
Involved Diseases
glaucoma /
Involved Pathways
Molecules associated with elastic fibres /
Sequence
ATGAGGCCGCGGACCAAAGCCCGCAGCCCGGGGCGCGCCCTGCGGAACCCCTGGAGAGGCTTCCTGCCGCTCACCCTGGCTCTCTTCGTGGGCGCGGGTCATGCCCAAAGGGACCCCGTAGGGAGATACGAGCCGGCTGGTGGAGACGCGAATCGACTGCGGCGCCCTGGGGGCAGCTACCCGGCAGCGGCTGCAGCCAAGGTGTACAGTCTGTTCCGGGAGCAGGACGCGCCTGTCGCGGGCTTGCAGCCCGTGGAGCGGGCCCAGCCGGGCTGGGGGAGCCCCAGGAGGCCCACCGAGGCGGAGGCCAGGAGGCCGTCCCGCGCGCAGCAGTCGCGGCGTGTCCAGCCACCTGCGCAGACCCGGAGAAGCACTCCCCTGGGCCAGCAGCAACCAGCACCCCGGACCCGGGCCGCGCCGGCTCTCCCACGCCTGGGGACCCCACAGCGGTCTGGGGCTGCGCCCCCAACCCCGCCGCGAGGGCGGCTCACGGGGAGGAACGTCTGCGGGGGACAGTGCTGCCCAGGATGGACAACAGCAAACAGCACCAACCACTGTATCAAACCCGTTTGCGAGCCGCCGTGCCAGAACCGGGGCTCCTGCAGCCGCCCGCAGCTCTGTGTCTGCCGCTCTGGTTTCCGTGGAGCCCGCTGCGAGGAGGTCATTCCCGATGAGGAATTTGACCCCCAGAACTCCAGGCTGGCACCTCGACGCTGGGCCGAGCGTTCACCCAACCTGCGCAGGAGCAGTGCGGCTGGAGAGGGCACCTTGGCCAGAGCACAGCCGCCAGCACCACAGTCGCCGCCCGCACCACAGTCGCCACCAGCTGGGACCCTGAGTGGCCTCAGCCAGACCCACCCTTCCCAGCAGCACGTGGGGTTGTCCCGCACTGTCCGACTTCACCCGACTGCCACGGCCAGTAGCCAGCTCTCTTCCAACGCCCTGCCCCCGGGACCAGGCCTTGAGCAGAGAGATGGCACCCAACAGGCGGTACCTCTGGAGCACCCCTCATCCCCCTGGGGGCTGAACCTCACGGAGAAAATCAAGAAGATCAAGATCGTCTTCACTCCCACCATCTGCAAGCAGACCTGTGCCCGTGGACACTGTGCCAACAGCTGTGAGAGGGGCGACACCACCACCCTGTACAGCCAGGGCGGCCATGGGCACGATCCCAAGTCTGGCTTCCGCATCTATTTCTGCCAGATCCCCTGCCTGAACGGAGGCCGCTGCATCGGCAGGGACGAATGCTGGTGCCCCGCCAACTCCACCGGGAAGTTCTGCCACCTGCCTATCCCGCAGCCGGACAGGGAGCCTCCAGGGAGGGGGTCCCGCCCCAGGGCCTTGCTGGAAGCCCCACTGAAGCAGTCCACTTTCACACTGCCGCTCTCCAACCAGCTGGCCTCCGTGAACCCCTCCCTGGTGAAGGTGCACATTCACCACCCACCCGAGGCCTCAGTGCAGATCCACCAGGTGGCCCAGGTGCGGGGCGGGGTGGAGGAGGCCCTAGTGGAGAACAGCGTGGAGACCAGACCCCCGCCCTGGCTGCCTGCCAGCCCTGGCCACAGCCTCTGGGACAGCAACAACATCCCTGCTCGGTCTGGAGAGCCCCCTCGGCCACTGCCCCCAGCAGCACCCAGGCCTCGAGGACTGCTGGGCCGGTGTTACCTGAACACTGTGAACGGACAGTGTGCCAACCCTCTGCTGGAGCTGACTACCCAGGAGGACTGCTGTGGCAGTGTGGGAGCCTTCTGGGGGGTGACTTTGTGTGCCCCATGCCCACCCAGACCAGCCTCCCCGGTGATTGAGAATGGCCAGCTGGAGTGTCCTCAGGGGTACAAGAGACTGAACCTCACTCACTGCCAAGATATCAACGAGTGCTTGACCCTGGGCCTGTGCAAGGACGCGGAGTGTGTGAATACCAGGGGCAGCTACCTGTGCACATGCAGACCTGGCCTCATGCTGGATCCATCGCGGAGCCGCTGTGTGTCGGACAAGGCAATCTCCATGCTGCAGGGACTGTGCTACCGGTCGCTGGGGCCCGGCACCTGCACCCTGCCTTTGGCCCAGCGGATCACCAAGCAGATATGCTGCTGCAGCCGCGTGGGCAAAGCATGGGGCAGCGAGTGTGAGAAATGCCCTCTGCCTGGCACAGAGGCCTTCAGAGAGATCTGCCCTGCCGGCCACGGCTACACCTACGCGAGCTCCGACATCCGCCTGTCCATGAGGAAAGCCGAGGAGGAGGAACTGGCAAGGCCCCCAAGGGAGCAAGGGCAGAGGAGCAGCGGGGCACTGCCCGGGCCAGCAGAGAGGCAGCCCCTCCGGGTCGTCACGGACACCTGGCTTGAGGCCGGGACCATCCCTGACAAGGGTGACTCTCAGGCTGGCCAGGTCACGACCAGTGTCACTCATGCACCTGCCTGGGTCACAGGGAATGCCACAACCCCACCAATGCCTGAACAGGGGATTGCAGAGATACAGGAAGAACAAGTGACCCCCTCCACTGATGTGCTGGTGACCCTGAGCACCCCAGGCATTGACAGATGCGCTGCTGGAGCCACCAACGTCTGTGGCCCTGGAACCTGCGTGAACCTCCCCGATGGATACAGATGTGTCTGCAGCCCTGGCTACCAGCTGCACCCCAGCCAGGCCTACTGCACAGATGACAACGAGTGTCTGAGGGACCCCTGCAAGGGAAAAGGGCGCTGCATCAACCGCGTGGGGTCCTACTCCTGCTTCTGCTACCCTGGCTACACTCTGGCCACCTCAGGGGCGACACAGGAGTGTCAAGATATCAATGAGTGTGAGCAGCCAGGGGTGTGCAGCGGGGGGCAGTGCACCAACACCGAGGGCTCGTACCACTGCGAGTGTGATCAGGGCTACATCATGGTCAGGAAAGGACACTGCCAAGATATCAACGAATGCCGTCACCCCGGTACCTGCCCTGATGGGAGATGCGTCAATTCCCCTGGCTCCTACACTTGTCTGGCCTGTGAGGAGGGCTACCGGGGCCAGAGTGGGAGCTGTGTAGATGTGAATGAGTGTCTGACTCCCGGGGTCTGTGCCCATGGAAAGTGCACCAACCTAGAAGGCTCCTTCAGATGCTCTTGTGAGCAGGGCTATGAGGTCACCTCAGATGAGAAGGGCTGCCAAGATGTGGATGAGTGTGCCAGCCGGGCCTCATGCCCCACAGGCCTCTGCCTCAACACGGAGGGCTCCTTCGCCTGCTCTGCCTGTGAGAACGGGTACTGGGTGAATGAAGACGGCACTGCCTGTGAAGACCTAGATGAGTGTGCCTTCCCGGGAGTCTGCCCCTCCGGAGTCTGCACCAACACGGCTGGCTCCTTCTCCTGCAAGGACTGCGATGGGGGCTACCGGCCCAGCCCCCTGGGTGACTCCTGTGAAGATGTGGATGAATGTGAAGACCCCCAGAGCAGCTGCCTGGGAGGCGAGTGCAAGAACACTGTGGGCTCCTACCAGTGCCTCTGTCCCCAGGGCTTCCAGCTGGCCAATGGCACCGTGTGTGAGGATGTGAATGAGTGCATGGGGGAGGAGCACTGCGCACCCCACGGCGAGTGCCTCAACAGCCACGGGTCTTTCTTCTGTCTGTGCGCGCCTGGCTTCGTCAGCGCAGAGGGGGGCACCAGCTGCCAGGATGTGGACGAGTGTGCCACCACAGACCCGTGTGTGGGAGGGCACTGTGTCAACACCGAGGGCTCCTTCAACTGTCTATGTGAGACTGGCTTCCAGCCCTCCCCAGAGAGTGGAGAGTGTGTGGATATTGACGAGTGTGAGGACTATGGAGACCCGGTGTGTGGCACCTGGAAGTGTGAAAACAGCCCTGGCTCCTACCGCTGTGTTCTGGGCTGCCAGCCTGGCTTCCACATGGCCCCGAACGGAGACTGCATTGACATAGACGAGTGCGCCAACGACACCATGTGTGGCAGCCACGGCTTCTGTGACAACACTGATGGCTCCTTCCGCTGCCTCTGTGACCAGGGCTTCGAGATCTCTCCCTCAGGCTGGGACTGTGTGGATGTGAACGAGTGTGAGCTTATGCTGGCGGTATGTGGGGCCGCGCTCTGTGAGAACGTGGAGGGCTCCTTCCTGTGCCTCTGTGCCAGTGACCTGGAGGAGTACGATGCCCAGGAGGGGCACTGCCGCCCACGGGGGGCTGGAGGTCAGAGTATGTCTGAGGCCCCAACGGGGGACCATGCCCCGGCCCCCACCCGCATGGACTGCTACTCCGGGCAGAAGGGCCATGCGCCCTGCTCCAGTGTCCTGGGCCGGAACACCACACAGGCTGAATGCTGCTGCACCCAGGGCGCTAGCTGGGGAGATGCCTGTGACCTCTGCCCGTCTGAGGACTCAGCTGAATTCAGCGAGATCTGCCCTAGTGGAAAAGGCTACATTCCTGTGGAAGGAGCCTGGACGTTTGGACAGACCATGTACACAGATGCGGATGAGTGTGTGATATTCGGGCCTGGTCTCTGCCCGAACGGCCGGTGCCTCAACACCGTGCCTGGTTATGTCTGCCTGTGCAATCCCGGCTTCCACTACGATGCTTCCCACAAGAAGTGTGAGGATCACGATGAGTGCCAGGACCTGGCCTGTGAGAATGGCGAGTGCGTCAACACGGAGGGCTCCTTCCACTGCTTCTGCAGCCCCCCGCTCACCCTGGACCTCAGCCAGCAGCGCTGCATGAACAGCACCAGCAGCACGGAGGACCTCCCTGACCACGACATCCACATGGACATCTGCTGGAAAAAAGTCACCAATGATGTGTGCAGCGAACCCCTGCGTGGGCACCGCACCACCTACACGGAATGCTGCTGCCAGGACGGCGAGGCCTGGAGCCAGCAGTGTGCTCTGTGTCCCCCGAGGAGCTCTGAGGTCTATGCTCAGCTGTGCAACGTGGCTCGCATTGAGGCAGAGCGGGAGGCCGGGGTCCACTTCCGGCCAGGCTATGAGTATGGCCCCGGGCCCGATGACCTGCACTACAGCATCTATGGCCCAGATGGGGCCCCCTTCTACAACTACCTGGGCCCCGAGGACACCGTCCCTGAGCCTGCCTTCCCCAACACAGCCGGTCACTCAGCGGACCGCACACCCATCCTTGAGTCTCCTTTGCAGCCCTCAGAACTCCAGCCCCACTACGTGGCCAGCCATCCAGAGCCCCCAGCCGGCTTCGAAGGGCTTCAGGCGGAGGAGTGCGGCATCCTGAACGGCTGTGAGAATGGCCGCTGTGTGCGCGTGCGGGAGGGCTACACCTGTGACTGTTTTGAGGGCTTCCAGCTGGATGCGGCCCACATGGCCTGCGTAGATGTGAATGAGTGTGATGACTTGAACGGGCCTGCTGTGCTCTGTGTCCATGGTTACTGCGAGAACACAGAGGGCTCCTACCGCTGCCACTGCTCCCCGGGATATGTGGCTGAGGCAGGGCCCCCCCACTGCACTGCCAAGGAGTAG

Back to List