Details for gene: LRP5


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
LRP5
Name
LDL receptor related protein 5
Entrez ID
4041
Ensembl ID
ENSG00000162337    (more details)
KEGG ID
hsa:4041    (more details)
OMIM ID
603506
Uniprot ID
O75197  
GO ID
hsa:4041    (more details)
Chromosome
11
Strand
1
Start
68312591
End
68449275
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-2355-3p (RPM: 0.4574) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-1229-3p (RPM: 1.3764) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-627-5p (RPM: 0.771) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-941 (RPM: 399.631) /
Involved Diseases
proliferative vitreoretinopathy (PVR) /
Involved Pathways
Pathways in cancer / Alzheimer's disease / mTOR signaling pathway / Wnt signaling pathway / TCF dependent signaling in response to WNT / Disassembly of the destruction complex and recruitment of AXIN to the membrane / Negative regulation of TCF-dependent signaling by WNT ligand antagonists / Regulation of FZD by ubiquitination / Signaling by LRP5 mutants / Signaling by RNF43 mutants / Pathways of neurodegeneration - multiple diseases / Parathyroid hormone synthesis, secretion and action / Breast cancer / Hepatocellular carcinoma / Gastric cancer /
Sequence
ATGGAGGCAGCGCCGCCCGGGCCGCCGTGGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGGCGCTGTGCGGCTGCCCGGCCCCCGCCGCGGCCTCGCCGCTCCTGCTATTTGCCAACCGCCGGGACGTACGGCTGGTGGACGCCGGCGGAGTCAAGCTGGAGTCCACCATCGTGGTCAGCGGCCTGGAGGATGCGGCCGCAGTGGACTTCCAGTTTTCCAAGGGAGCCGTGTACTGGACAGACGTGAGCGAGGAGGCCATCAAGCAGACCTACCTGAACCAGACGGGGGCCGCCGTGCAGAACGTGGTCATCTCCGGCCTGGTCTCTCCCGACGGCCTCGCCTGCGACTGGGTGGGCAAGAAGCTGTACTGGACGGACTCAGAGACCAACCGCATCGAGGTGGCCAACCTCAATGGCACATCCCGGAAGGTGCTCTTCTGGCAGGACCTTGACCAGCCGAGGGCCATCGCCTTGGACCCCGCTCACGGGTACATGTACTGGACAGACTGGGGTGAGACGCCCCGGATTGAGCGGGCAGGGATGGATGGCAGCACCCGGAAGATCATTGTGGACTCGGACATTTACTGGCCCAATGGACTGACCATCGACCTGGAGGAGCAGAAGCTCTACTGGGCTGACGCCAAGCTCAGCTTCATCCACCGTGCCAACCTGGACGGCTCGTTCCGGCAGAAGGTGGTGGAGGGCAGCCTGACGCACCCCTTCGCCCTGACGCTCTCCGGGGACACTCTGTACTGGACAGACTGGCAGACCCGCTCCATCCATGCCTGCAACAAGCGCACTGGGGGGAAGAGGAAGGAGATCCTGAGTGCCCTCTACTCACCCATGGACATCCAGGTGCTGAGCCAGGAGCGGCAGCCTTTCTTCCACACTCGCTGTGAGGAGGACAATGGCGGCTGCTCCCACCTGTGCCTGCTGTCCCCAAGCGAGCCTTTCTACACATGCGCCTGCCCCACGGGTGTGCAGCTGCAGGACAACGGCAGGACGTGTAAGGCAGGAGCCGAGGAGGTGCTGCTGCTGGCCCGGCGGACGGACCTACGGAGGATCTCGCTGGACACGCCGGACTTCACCGACATCGTGCTGCAGGTGGACGACATCCGGCACGCCATTGCCATCGACTACGACCCGCTAGAGGGCTATGTCTACTGGACAGATGACGAGGTGCGGGCCATCCGCAGGGCGTACCTGGACGGGTCTGGGGCGCAGACGCTGGTCAACACCGAGATCAACGACCCCGATGGCATCGCGGTCGACTGGGTGGCCCGAAACCTCTACTGGACCGACACGGGCACGGACCGCATCGAGGTGACGCGCCTCAACGGCACCTCCCGCAAGATCCTGGTGTCGGAGGACCTGGACGAGCCCCGAGCCATCGCACTGCACCCCGTGATGGGCCTCATGTACTGGACAGACTGGGGAGAGAACCCTAAAATCGAGTGTGCCAACTTGGATGGGCAGGAGCGGCGTGTGCTGGTCAATGCCTCCCTCGGGTGGCCCAACGGCCTGGCCCTGGACCTGCAGGAGGGGAAGCTCTACTGGGGAGACGCCAAGACAGACAAGATCGAGGTGATCAATGTTGATGGGACGAAGAGGCGGACCCTCCTGGAGGACAAGCTCCCGCACATTTTTGGGTTCACGCTGCTGGGGGACTTCATCTACTGGACTGACTGGCAGCGCCGCAGCATCGAGCGGGTGCACAAGGTCAAGGCCAGCCGGGACGTCATCATTGACCAGCTGCCCGACCTGATGGGGCTCAAAGCTGTGAATGTGGCCAAGGTCGTCGGAACCAACCCGTGTGCGGACAGGAACGGGGGGTGCAGCCACCTGTGCTTCTTCACACCCCACGCAACCCGGTGTGGCTGCCCCATCGGCCTGGAGCTGCTGAGTGACATGAAGACCTGCATCGTGCCTGAGGCCTTCTTGGTCTTCACCAGCAGAGCCGCCATCCACAGGATCTCCCTCGAGACCAATAACAACGACGTGGCCATCCCGCTCACGGGCGTCAAGGAGGCCTCAGCCCTGGACTTTGATGTGTCCAACAACCACATCTACTGGACAGACGTCAGCCTGAAGACCATCAGCCGCGCCTTCATGAACGGGAGCTCGGTGGAGCACGTGGTGGAGTTTGGCCTTGACTACCCCGAGGGCATGGCCGTTGACTGGATGGGCAAGAACCTCTACTGGGCCGACACTGGGACCAACAGAATCGAAGTGGCGCGGCTGGACGGGCAGTTCCGGCAAGTCCTCGTGTGGAGGGACTTGGACAACCCGAGGTCGCTGGCCCTGGATCCCACCAAGGGCTACATCTACTGGACCGAGTGGGGCGGCAAGCCGAGGATCGTGCGGGCCTTCATGGACGGGACCAACTGCATGACGCTGGTGGACAAGGTGGGCCGGGCCAACGACCTCACCATTGACTACGCTGACCAGCGCCTCTACTGGACCGACCTGGACACCAACATGATCGAGTCGTCCAACATGCTGGGTCAGGAGCGGGTCGTGATTGCCGACGATCTCCCGCACCCGTTCGGTCTGACGCAGTACAGCGATTATATCTACTGGACAGACTGGAATCTGCACAGCATTGAGCGGGCCGACAAGACTAGCGGCCGGAACCGCACCCTCATCCAGGGCCACCTGGACTTCGTGATGGACATCCTGGTGTTCCACTCCTCCCGCCAGGATGGCCTCAATGACTGTATGCACAACAACGGGCAGTGTGGGCAGCTGTGCCTTGCCATCCCCGGCGGCCACCGCTGCGGCTGCGCCTCACACTACACCCTGGACCCCAGCAGCCGCAACTGCAGCCCGCCCACCACCTTCTTGCTGTTCAGCCAGAAATCTGCCATCAGTCGGATGATCCCGGACGACCAGCACAGCCCGGATCTCATCCTGCCCCTGCATGGACTGAGGAACGTCAAAGCCATCGACTATGACCCACTGGACAAGTTCATCTACTGGGTGGATGGGCGCCAGAACATCAAGCGAGCCAAGGACGACGGGACCCAGCCCTTTGTTTTGACCTCTCTGAGCCAAGGCCAAAACCCAGACAGGCAGCCCCACGACCTCAGCATCGACATCTACAGCCGGACACTGTTCTGGACGTGCGAGGCCACCAATACCATCAACGTCCACAGGCTGAGCGGGGAAGCCATGGGGGTGGTGCTGCGTGGGGACCGCGACAAGCCCAGGGCCATCGTCGTCAACGCGGAGCGAGGGTACCTGTACTTCACCAACATGCAGGACCGGGCAGCCAAGATCGAACGCGCAGCCCTGGACGGCACCGAGCGCGAGGTCCTCTTCACCACCGGCCTCATCCGCCCTGTGGCCCTGGTGGTGGACAACACACTGGGCAAGCTGTTCTGGGTGGACGCGGACCTGAAGCGCATTGAGAGCTGTGACCTGTCAGGGGCCAACCGCCTGACCCTGGAGGACGCCAACATCGTGCAGCCTCTGGGCCTGACCATCCTTGGCAAGCATCTCTACTGGATCGACCGCCAGCAGCAGATGATCGAGCGTGTGGAGAAGACCACCGGGGACAAGCGGACTCGCATCCAGGGCCGTGTCGCCCACCTCACTGGCATCCATGCAGTGGAGGAAGTCAGCCTGGAGGAGTTCTCAGCCCACCCATGTGCCCGTGACAATGGTGGCTGCTCCCACATCTGTATTGCCAAGGGTGATGGGACACCACGGTGCTCATGCCCAGTCCACCTCGTGCTCCTGCAGAACCTGCTGACCTGTGGAGAGCCGCCCACCTGCTCCCCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGGCGCTGTGACGGCTTTCCCGAGTGCGATGACCAGAGCGACGAGGAGGGCTGCCCCGTGTGCTCCGCCGCCCAGTTCCCCTGCGCGCGGGGTCAGTGTGTGGACCTGCGCCTGCGCTGCGACGGCGAGGCAGACTGTCAGGACCGCTCAGACGAGGCGGACTGTGACGCCATCTGCCTGCCCAACCAGTTCCGGTGTGCGAGCGGCCAGTGTGTCCTCATCAAACAGCAGTGCGACTCCTTCCCCGACTGTATCGACGGCTCCGACGAGCTCATGTGTGAAATCACCAAGCCGCCCTCAGACGACAGCCCGGCCCACAGCAGTGCCATCGGGCCCGTCATTGGCATCATCCTCTCTCTCTTCGTCATGGGTGGTGTCTATTTTGTGTGCCAGCGCGTGGTGTGCCAGCGCTATGCGGGGGCCAACGGGCCCTTCCCGCACGAGTATGTCAGCGGGACCCCGCACGTGCCCCTCAATTTCATAGCCCCGGGCGGTTCCCAGCATGGCCCCTTCACAGGCATCGCATGCGGAAAGTCCATGATGAGCTCCGTGAGCCTGATGGGGGGCCGGGGCGGGGTGCCCCTCTACGACCGGAACCACGTCACAGGGGCCTCGTCCAGCAGCTCGTCCAGCACGAAGGCCACGCTGTACCCGCCGATCCTGAACCCGCCGCCCTCCCCGGCCACGGACCCCTCCCTGTACAACATGGACATGTTCTACTCTTCAAACATTCCGGCCACTGCGAGACCGTACAGGCCCTACATCATTCGAGGAATGGCGCCCCCGACGACGCCCTGCAGCACCGACGTGTGTGACAGCGACTACAGCGCCAGCCGCTGGAAGGCCAGCAAGTACTACCTGGATTTGAACTCGGACTCAGACCCCTATCCACCCCCACCCACGCCCCACAGCCAGTACCTGTCGGCGGAGGACAGCTGCCCGCCCTCGCCCGCCACCGAGAGGAGCTACTTCCATCTCTTCCCGCCCCCTCCGTCCCCCTGCACGGACTCATCCTGA

Back to List