Details for gene: CACNA1A


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
CACNA1A
Name
calcium voltage-gated channel subunit alpha1 A
Entrez ID
773
Ensembl ID
ENSG00000141837    (more details)
KEGG ID
hsa:773    (more details)
OMIM ID
601011
Uniprot ID
O00555  
GO ID
hsa:773    (more details)
Chromosome
19
Strand
-1
Start
13206442
End
13633025
miRNA Interactions
hsa-miR-515-5p (RPM: 0.18) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-548c-3p (RPM: 0.0894) / hsa-miR-3911 (RPM: 0.0924) / hsa-miR-607 (RPM: 0.001) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-632 (RPM: 0.0074) / hsa-miR-5087 (RPM: 0.0074) / hsa-miR-33a-3p (RPM: 1.692) / hsa-miR-605-5p (RPM: 0.3176) / hsa-miR-346 (RPM: 2.6286) / hsa-miR-1260a (RPM: 220.2948) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-2355-5p (RPM: 2.178) / hsa-miR-4762-5p (RPM: 0.0998) / hsa-miR-212-5p (RPM: 3.5846) / hsa-miR-188-5p (RPM: 3.7746) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-532-3p (RPM: 21.9476) / hsa-miR-5695 (RPM: 0.4768) / hsa-miR-193b-5p (RPM: 3.2336) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-4780 (RPM: 0.2546) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-4687-3p (RPM: 0.149) / hsa-miR-1224-3p (RPM: 0.0484) / hsa-miR-767-3p (RPM: 0.3502) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-642b-5p (RPM: 0.1552) / hsa-miR-4749-5p (RPM: 0.337) / hsa-miR-1260b (RPM: 243.165) / hsa-miR-4734 (RPM: 0.0874) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-383-5p (RPM: 1.9172) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-6842-3p (RPM: 11.8838) / hsa-miR-6752-3p (RPM: 0.0008) / hsa-miR-6747-3p (RPM: 0.3694) / hsa-miR-6866-3p (RPM: 0.0468) / hsa-miR-519d-5p (RPM: 0.0022) / hsa-miR-6780b-3p (RPM: 0.0072) / hsa-miR-7106-3p (RPM: 0.0112) / hsa-miR-6836-3p (RPM: 0.019) / hsa-miR-6829-3p (RPM: 0.0008) / hsa-miR-6791-3p (RPM: 0.0226) / hsa-miR-203a-5p (RPM: 0.8658) / hsa-miR-4706 (RPM: 0.1162) / hsa-miR-4485-5p (RPM: 0.143) / hsa-miR-6516-3p (RPM: 0.5714) / hsa-miR-6793-3p (RPM: 0.0968) / hsa-miR-7113-3p (RPM: 0.0052) / hsa-miR-7974 (RPM: 3.4298) /
Involved Diseases
Exfoliation syndrome (XFS) /
Involved Pathways
MAPK signaling pathway / Calcium signaling pathway / Serotonergic synapse / GABAergic synapse / Retrograde endocannabinoid signaling / Glutamatergic synapse / Dopaminergic synapse / Nicotine addiction / Cholinergic synapse / Type II diabetes mellitus / Long-term depression / Taste transduction / Regulation of insulin secretion / Presynaptic depolarization and calcium channel opening / Chemical carcinogenesis - receptor activation / Synaptic vesicle cycle / Spinocerebellar ataxia / Morphine addiction /
Sequence
ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTCCGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCGGGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAGTCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGTCCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAGACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGTCCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTGAACGGCTGGATGACACAGAACCATACTTCATTGGAATTTTTTGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAAAGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGCTAACGGGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTACGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGGAATCCCAAGTTTACAAGTCGTCCTGAAGTCGATCATGAAGGCGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTTATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCACCTGCTTTGAAGAGGGGACAGATGACATTCAGGGTGAGTCTCCGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACCAAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGACAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAGGGTGGACTGATCTCCTCTACAATAGCAACGATGCCTCAGGGAACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTTTTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGGAGTTTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTGAGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGATCTCAAAAGCAGAAGAGGTGATCCTCGCCGAGGATGAAACTGACGGGGAGCAGAGGCATCCCTTTGATGCTCTGCGGAGAACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGAGGATCAGCTGGCTGATATAGCCTCTGTGGGTTCTCCCTTCGCCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCACAAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCAGGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTGTTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAATGTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCTTCAACTGCTTTGACTGTGGGGTTATCATTGGGAGCATCTTCGAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGTGTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATGAAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTTCGCCCTTTTGGGAATGCAACTCTTCGGCGGCCAGTTTAATTTCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATAATGACGGTGTTTCAGATCCTGACGGGCGAAGACTGGAACGAGGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGGTGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAACGCCCAGGAGCTCACCAAGGACGAGCAAGAGGAAGAAGAAGCAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTGAGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGTGAAAGAGCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCAGTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAACGAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCGGCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGGAGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTGGACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGCCCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACGCACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGACCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCAACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCCACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGGTCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCGCAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGCACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGCCCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCACGTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGAGGAAAGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCCAACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCCACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCGCGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCATCCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCAACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAATAGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGACTGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCACCCCCCCTCAACCACACCGTCGTACAAGTGAACAAAAACGCCAACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGAAGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCATGTTCATCCTGTCCACGACCAACCCCCTTCGCCGCCTGTGCCATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCATTGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACGCACCTCGGAACAACGTGCTGCGATACTTTGACTACGTTTTTACAGGCGTCTTTACCTTTGAGATGGTGATCAAGATGATTGACCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATATTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCACTGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCTCCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAAAGCTCAAGGCTGTGTTTGACTGTGTGGTGAACTCACTTAAAAACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGCCGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACGAGTCCAAAGAGTTTGAGAAAGATTGTCGAGGCAAATACCTCCTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTATGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCGTGTCCACGGGAGAAGGCTGGCCACAGGTCCTCAAGCATTCGGTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGAGATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTGTCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAATGAGAGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCGCCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCTTATGATGAAGTTCTATGGGGCTTCTGTTGCTTATGAAAATGCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGTGCTGAAAGTCATGGCTTTTGGGATTCTGAATTATTTCCGCGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCGATATCCTCGTGACTGAGTTTGGGAATAACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAGGCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAGGTGTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTGAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGCTCGTTTCTGATGCTGAATCTCTTTGTCGCCGTCATCATGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACCTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGGGCCGCATGCCTTACCTGGACATGTATCAGATGCTGAGACACATGTCTCCGCCCCTGGGTCTGGGGAAGAAGTGTCCGGCCAGAGTGGCTTACAAGCGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCCAAGGGAGGAGCCGACAAACAGCAGATGGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAGAAGACGCTAGACCTGCTGGTCACACCTCACAAGTCCACGGACCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAGGACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACCCAGGAGGAGCCCTGATGGCTCACGAAAGCGGCCTCAAGGAGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGCCTAACTCTCAGTCCGTGGAGATGCGAGAGATGGGCAGAGATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGAGGAGAAGGGGCCGGCCACGTGGGAATAACCTCAGTACCATCTCAGACACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACGCCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGCACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTGGGCCGCTACACCGATGTGGACACAGGCTTGGGGACAGACCTGAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCACCACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGGCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCCCCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGCCAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCACGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGAGTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGGGGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGAGGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCTCGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCCGGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGCACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAA

Back to List