Details for gene: AGPAT1


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
AGPAT1
Name
1-acylglycerol-3-phosphate O-acyltransferase 1
Entrez ID
10554
Ensembl ID
ENSG00000204310    (more details)
KEGG ID
hsa:10554    (more details)
OMIM ID
603099
Uniprot ID
Q99943  
GO ID
hsa:10554    (more details)
Chromosome
6
Strand
-1
Start
32168212
End
32178096
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-4753-3p (RPM: 0.0312) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-1285-3p (RPM: 7.2094) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1226-5p (RPM: 0.426) / hsa-miR-187-5p (RPM: 0.2682) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-873-5p (RPM: 18.2502) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-940 (RPM: 4.614) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-146b-3p (RPM: 16.408) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-873-3p (RPM: 8.911) / hsa-miR-146a-3p (RPM: 0.066) / hsa-miR-425-5p (RPM: 187.631) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-6873-3p (RPM: 0.12) / hsa-miR-7110-3p (RPM: 0.0382) / hsa-miR-6817-3p (RPM: 0.0036) /
Involved Diseases
Exfoliation syndrome (XFS) /
Involved Pathways
Metabolic pathways / Glycerolipid metabolism / Glycerophospholipid metabolism / ChREBP activates metabolic gene expression / Synthesis of PA / Fat digestion and absorption / Phospholipase D signaling pathway /
Sequence
ATGGATTTGTGGCCAGGGGCATGGATGCTGCTGCTGCTGCTCTTCCTGCTGCTGCTCTTCCTGCTGCCCACCCTGTGGTTCTGCAGCCCCAGTGCCAAGTACTTCTTCAAGATGGCCTTCTACAATGGCTGGATCCTCTTCCTGGCTGTGCTCGCCATCCCTGTGTGTGCCGTGCGAGGACGCAACGTCGAGAACATGAAGATCTTGCGTCTAATGCTGCTCCACATCAAATACCTGTACGGGATCCGAGTGGAGGTGCGAGGGGCTCACCACTTCCCTCCCTCGCAGCCCTATGTTGTTGTCTCCAACCACCAGAGCTCTCTCGATCTGCTTGGGATGATGGAGGTACTGCCAGGCCGCTGTGTGCCCATTGCCAAGCGCGAGCTACTGTGGGCTGGCTCTGCCGGGCTGGCCTGCTGGCTGGCAGGAGTCATCTTCATCGACCGGAAGCGCACGGGGGATGCCATCAGTGTCATGTCTGAGGTCGCCCAGACCCTGCTCACCCAGGACGTGAGGGTCTGGGTGTTTCCTGAGGGAACGAGAAACCACAATGGCTCCATGCTGCCCTTCAAACGTGGCGCCTTCCATCTTGCAGTGCAGGCCCAGGTTCCCATTGTCCCCATAGTCATGTCCTCCTACCAAGACTTCTACTGCAAGAAGGAGCGTCGCTTCACCTCGGGACAATGTCAGGTGCGGGTGCTGCCCCCAGTGCCCACGGAAGGGCTGACACCAGATGACGTCCCAGCTCTGGCTGACAGAGTCCGGCACTCCATGCTCACTGTTTTCCGGGAAATCTCCACTGATGGCCGGGGTGGTGGTGACTATCTGAAGAAGCCTGGGGGCGGTGGGTGA

Back to List