Details for gene: RBMS3


This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.


Symbol
RBMS3
Name
RNA binding motif single stranded interacting protein 3
Entrez ID
27303
Ensembl ID
ENSG00000144642    (more details)
KEGG ID
hsa:27303    (more details)
OMIM ID
605786
Uniprot ID
Q6XE24  
GO ID
hsa:27303    (more details)
Chromosome
3
Strand
1
Start
28574791
End
30010391
miRNA Interactions
hsa-miR-3190-3p (RPM: 0.0858) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-578 (RPM: 0.0174) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-4703-3p (RPM: 0.3698) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-5706 (RPM: 0.0472) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-4782-5p (RPM: 0.003) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-5093 (RPM: 0.0162) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-1299 (RPM: 7.6252) / hsa-miR-653-5p (RPM: 3.9202) / hsa-miR-516b-5p (RPM: 0.283) / hsa-miR-1238-3p (RPM: 0.0018) / hsa-miR-526b-5p (RPM: 0.2456) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-3674 (RPM: 0.0024) / hsa-miR-139-3p (RPM: 0.998) / hsa-miR-670-3p (RPM: 1.3964) / hsa-miR-6780a-3p (RPM: 0.023) / hsa-miR-6128 (RPM: 0.0022) / hsa-miR-6881-3p (RPM: 0.2412) / hsa-miR-7111-3p (RPM: 0.0388) /
Involved Diseases
Exfoliation syndrome (XFS) /
Involved Pathways
Sequence
ATGGGCAAACGCCTGGATCAGCCACAAATGTACCCCCAGTACACTTACTACTATCCTCATTATCTCCAAACCAAGCAGTCCTATGCACCAGCTCCCCACCCCATGGCTCCTCCCAGCCCCAGCACAAACAGCAGCAGCAACAACAGCAGCAACAACAGCAGCGGGGAACAGTTGAGTAAAACCAACCTGTACATTCGAGGCCTCCCACCAGGCACCACTGACCAGGACCTAATCAAGCTGTGCCAACCGTATGGAAAAATTGTATCTACAAAGGCAATTCTTGACAAAAACACAAATCAGTGCAAAGGTTATGGTTTTGTAGATTTTGACAGTCCTGCAGCCGCACAGAAAGCGGTAGCATCTCTCAAGGCAAATGGCGTGCAGGCACAGATGGCTAAGCAACAAGAGCAAGACCCAACAAACCTATACATCTCAAATCTCCCCATTTCTATGGATGAGCAGGAGCTTGAGAATATGCTGAAACCCTTTGGACATGTCATTTCCACAAGAATACTAAGAGACGCTAATGGAGTCAGCAGAGGTGTTGGCTTTGCCAGAATGGAGTCTACTGAAAAATGTGAAGTGGTAATTCAACATTTTAATGGAAAATATCTGAAAACACCACCAGGCATCCCAGCCCCCAGTGAGCCTTTGCTGTGCAAATTCGCTGATGGAGGACAAAAGAAGCGACAGAATCAAAGCAAATATACCCAGAATGGGAGGCCTTGGCCCAGGGAAGGAGAGGCTGGCATGGCTTTGACCTATGACCCCACAGCTGCCATACAGAATGGATTTTATTCTTCACCGTACAGTATTGCAACCAACCGCATGATTCCACAGACATCTATCACGCCATTCATTGCTGCTTCCCCTGTCTCCACATACCAGGTCCAGAGTACTTCATGGATGCCTCATCCGCCATACGTTATGCAACCAACAGGTGCTGTGATTACACCAACCATGGACCATCCCATGTCAATGCAGCCAGCCAACATGATGGGCCCACTGACACAGCAGATGAATCACCTTTCGTTGGGCACAACAGGAACGATTCAATCCCAAGACAGGATTATGATACTCCACCAGCTGTTGTGTCAGTATATGACTGCTGCTGCTCCTATGCAAGGGACCTACATTCCTCAGTACACGCCTGTGCCTCCGACAGCTGTTTCTATTGAAGGTGTTGTTGCTGATACCTCTCCCCAGACAGTGGCACCTTCATCCCAGGACACCAGTGGTCAGCAGCAACAGATAGCAGTGGACACATCCAACGAACATGCACCTGCATATTCTTACCAACAGTCTAAACCATAA

Back to List