Details for gene: POMP


The aggregation, arrangement and bonding together of a mature, active proteasome complex.


Symbol
POMP
Name
proteasome maturation protein
Entrez ID
51371
Ensembl ID
ENSG00000132963    (more details)
KEGG ID
hsa:51371    (more details)
OMIM ID
613386
Uniprot ID
Q9Y244  
GO ID
hsa:51371    (more details)
Chromosome
13
Strand
1
Start
28659104
End
28678959
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-302d-3p (RPM: 0.0012) / hsa-miR-302c-3p (RPM: 0.0012) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-302b-3p (RPM: 0.006) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-3177-5p (RPM: 0.1208) / hsa-miR-433-3p (RPM: 9.0888) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-4473 (RPM: 0.2418) / hsa-miR-194-3p (RPM: 0.633) / hsa-miR-423-3p (RPM: 1928.5158) /
Involved Diseases
Exfoliation syndrome (XFS) /
Involved Pathways
Proteasome /
Sequence
ATGAATGCCAGAGGACTTGGATCTGAGCTAAAGGACAGTATTCCAGTTACTGAACTTTCAGCAAGTGGACCTTTTGAAAGTCATGATCTTCTTCGGAAAGGTTTTTCTTGTGTGAAAAATGAACTTTTGCCTAGTCATCCCCTTGAATTATCAGAAAAAAATTTCCAGCTCAACCAAGATAAAATGAATTTTTCCACACTGAGAAACATTCAGGGTCTATTTGCTCCGCTAAAATTACAGATGGAATTCAAGGCAGTGCAGCAGGTTCAGCGTCTTCCATTTCTTTCAAGCTCAAATCTTTCACTGGATGTTTTGAGGGGTAATGATGAGACTATTGGATTTGAGGATATTCTTAATGATCCATCACAAAGCGAAGTCATGGGAGAGCCACACTTGATGGTGGAATATAAACTTGGTTTACTGTAA

Back to List