Details for gene: INPP5K


Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic.


Symbol
INPP5K
Name
inositol polyphosphate-5-phosphatase K
Entrez ID
51763
Ensembl ID
ENSG00000132376    (more details)
KEGG ID
hsa:51763    (more details)
OMIM ID
607875
Uniprot ID
Q9BT40  
GO ID
hsa:51763    (more details)
Chromosome
17
Strand
-1
Start
1494577
End
1516742
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-4786-3p (RPM: 0.0288) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-654-3p (RPM: 97.06) /
Involved Diseases
primary Sjögren's syndrome (pSS) /
Involved Pathways
Metabolic pathways / Inositol phosphate metabolism / Synthesis of PIPs at the plasma membrane /
Sequence
ATGAGCTCGCGGAAGCTGAGCGGGCCGAAAGGCAGGAGGCTCAGCATACACGTCGTGACTTGGAACGTGGCTTCGGCAGCGCCCCCTCTAGATCTCAGTGACCTGCTTCAGCTGAACAACCGGAACCTCAATCTTGACATATATGTTATTGGTTTGCAGGAATTGAACTCTGGGATCATAAGCCTCCTTTCCGATGCTGCCTTTAATGACTCGTGGAGCAGTTTCCTCATGGATGTGCTTTCCCCTCTGAGCTTCATCAAGGTCTCCCATGTCCGTATGCAGGGGATCCTCTTACTGGTCTTTGCCAAGTATCAGCATTTGCCCTATATCCAGATTCTGTCTACTAAATCCACCCCCACTGGCCTGTTTGGGTACTGGGGGAACAAAGGTGGAGTCAACATCTGCCTGAAGCTTTATGGCTACTATGTCAGCATCATCAACTGCCACCTGCCTCCCCACATTTCCAACAATTACCAGCGGCTGGAGCACTTTGACCGGATCCTGGAGATGCAGAATTGTGAGGGGCGAGACATCCCAAACATCCTGGACCACGACCTCATTATCTGGTTTGGAGACATGAACTTTCGGATCGAGGACTTTGGGTTGCACTTTGTTCGGGAATCCATTAAAAATCGGTGCTACGGTGGCCTGTGGGAGAAGGACCAGCTCAGCATTGCCAAGAAACATGACCCGCTGCTCCGGGAGTTCCAGGAGGGCCGCCTACTCTTCCCGCCCACCTACAAGTTTGATAGGAACTCCAACGACTATGACACCAGTGAGAAAAAACGCAAGCCTGCATGGACCGATCGCATCCTGTGGAGGCTGAAGCGGCAGCCCTGTGCTGGCCCCGACACTCCCATACCGCCGGCGTCACACTTCTCCTTGTCTCTGAGGGGCTACAGCAGCCACATGACGTACGGCATCAGCGACCACAAGCCTGTCTCCGGCACGTTCGACTTGGAGCTGAAGCCATTGGTGTCTGCTCCGCTGATCGTCCTGATGCCCGAGGACCTGTGGACCGTGGAAAATGACATGATGGTCAGCTACTCTTCAACCTCGGACTTCCCCAGCAGCCCGTGGGACTGGATTGGACTGTACAAGGTGGGGCTGCGGGACGTTAATGACTACGTGTCCTATGCCTGGGTCGGGGACAGCAAGGTCTCCTGCAGCGACAACCTGAACCAGGTTTACATCGACATCAGCAATATCCCTACCACTGAAGATGAGTTTCTCCTCTGTTACTACAGCAACAGTCTGCGTTCTGTGGTGGGGATAAGCAGACCCTTCCAGATCCCGCCTGGCTCCTTGAGGGAGGACCCACTGGGTGAAGCACAGCCACAGATCTGA

Back to List