Details for gene: SIL1


The directed movement of proteins in a cell, including the movement of proteins between specific compartments or structures within a cell, such as organelles of a eukaryotic cell.


Symbol
SIL1
Name
SIL1 nucleotide exchange factor
Entrez ID
64374
Ensembl ID
ENSG00000120725    (more details)
KEGG ID
hsa:64374    (more details)
OMIM ID
608005
Uniprot ID
Q9H173  
GO ID
hsa:64374    (more details)
Chromosome
5
Strand
-1
Start
138946724
End
139293557
miRNA Interactions
hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-369-3p (RPM: 7.3414) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-376a-3p (RPM: 4.1692) / hsa-miR-126-3p (RPM: 494.5936) /
Involved Diseases
primary Sjögren's syndrome (pSS) /
Involved Pathways
Protein processing in endoplasmic reticulum /
Sequence
ATGGCTCCCCAGAGCCTGCCTTCATCTAGGATGGCTCCTCTGGGCATGCTGCTTGGGCTGCTGATGGCCGCCTGCTTCACCTTCTGCCTCAGTCATCAGAACCTGAAGGAGTTTGCCCTGACCAACCCAGAGAAGAGCAGCACCAAAGAAACAGAGAGAAAAGAAACCAAAGCCGAGGAGGAGCTGGATGCCGAAGTCCTGGAGGTGTTCCACCCGACGCATGAGTGGCAGGCCCTTCAGCCAGGGCAGGCTGTCCCTGCAGGATCCCACGTACGGCTGAATCTTCAGACTGGGGAAAGAGAGGCAAAACTCCAATATGAGGACAAGTTCCGAAATAATTTGAAAGGCAAAAGGCTGGATATCAACACCAACACCTACACATCTCAGGATCTCAAGAGTGCACTGGCAAAATTCAAGGAGGGGGCAGAGATGGAGAGTTCAAAGGAAGACAAGGCAAGGCAGGCTGAGGTAAAGCGGCTCTTCCGCCCCATTGAGGAACTGAAGAAAGACTTTGATGAGCTGAATGTTGTCATTGAGACTGACATGCAGATCATGGTACGGCTGATCAACAAGTTCAATAGTTCCAGCTCCAGTTTGGAAGAGAAGATTGCTGCGCTCTTTGATCTTGAATATTATGTCCATCAGATGGACAATGCGCAGGACCTGCTTTCCTTTGGTGGTCTTCAAGTGGTGATCAATGGGCTGAACAGCACAGAGCCCCTCGTGAAGGAGTATGCTGCGTTTGTGCTGGGCGCTGCCTTTTCCAGCAACCCCAAGGTCCAGGTGGAGGCCATCGAAGGGGGAGCCCTGCAGAAGCTGCTGGTCATCCTGGCCACGGAGCAGCCGCTCACTGCAAAGAAGAAGGTCCTGTTTGCACTGTGCTCCCTGCTGCGCCACTTCCCCTATGCCCAGCGGCAGTTCCTGAAGCTCGGGGGGCTGCAGGTCCTGAGGACCCTGGTGCAGGAGAAGGGCACGGAGGTGCTCGCCGTGCGCGTGGTCACACTGCTCTACGACCTGGTCACGGAGAAGATGTTCGCCGAGGAGGAGGCTGAGCTGACCCAGGAGATGTCCCCAGAGAAGCTGCAGCAGTATCGCCAGGTACACCTCCTGCCAGGCCTGTGGGAACAGGGCTGGTGCGAGATCACGGCCCACCTCCTGGCGCTGCCCGAGCATGATGCCCGTGAGAAGGTGCTGCAGACACTGGGCGTCCTCCTGACCACCTGCCGGGACCGCTACCGTCAGGACCCCCAGCTCGGCAGGACACTGGCCAGCCTGCAGGCTGAGTACCAGGTGCTGGCCAGCCTGGAGCTGCAGGATGGTGAGGACGAGGGCTACTTCCAGGAGCTGCTGGGCTCTGTCAACAGCTTGCTGAAGGAGCTGAGATGA

Back to List