Details for gene: GFAP


A cytoskeletal structure that forms a distinct elongated structure, characteristically 10 nm in diameter, that occurs in the cytoplasm of eukaryotic cells. Intermediate filaments form a fibrous system, composed of chemically heterogeneous subunits and involved in mechanically integrating the various components of the cytoplasmic space. Intermediate filaments may be divided into five chemically distinct classes: Type I, acidic keratins; Type II, basic keratins; Type III, including desmin, vimentin and others; Type IV, neurofilaments and related filaments; and Type V, lamins.


Symbol
GFAP
Name
glial fibrillary acidic protein
Entrez ID
2670
Ensembl ID
ENSG00000131095    (more details)
KEGG ID
hsa:2670    (more details)
OMIM ID
137780
Uniprot ID
P14136  
GO ID
hsa:2670    (more details)
Chromosome
17
Strand
-1
Start
44903159
End
44916937
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-324-5p (RPM: 32.337) /
Involved Diseases
neuromyelitis optica (NMO) /
Involved Pathways
Jak-STAT signaling pathway / Chaperone Mediated Autophagy / Nuclear signaling by ERBB4 /
Sequence
ATGGAGAGGAGACGCATCACCTCCGCTGCTCGCCGCTCCTACGTCTCCTCAGGGGAGATGATGGTGGGGGGCCTGGCTCCTGGCCGCCGTCTGGGTCCTGGCACCCGCCTCTCCCTGGCTCGAATGCCCCCTCCACTCCCGACCCGGGTGGATTTCTCCCTGGCTGGGGCACTCAATGCTGGCTTCAAGGAGACCCGGGCCAGTGAGCGGGCAGAGATGATGGAGCTCAATGACCGCTTTGCCAGCTACATCGAGAAGGTTCGCTTCCTGGAACAGCAAAACAAGGCGCTGGCTGCTGAGCTGAACCAGCTGCGGGCCAAGGAGCCCACCAAGCTGGCAGACGTCTACCAGGCTGAGCTGCGAGAGCTGCGGCTGCGGCTCGATCAACTCACCGCCAACAGCGCCCGGCTGGAGGTTGAGAGGGACAATCTGGCACAGGACCTGGCCACTGTGAGGCAGAAGCTCCAGGATGAAACCAACCTGAGGCTGGAAGCCGAGAACAACCTGGCTGCCTATAGACAGGAAGCAGATGAAGCCACCCTGGCCCGTCTGGATCTGGAGAGGAAGATTGAGTCGCTGGAGGAGGAGATCCGGTTCTTGAGGAAGATCCACGAGGAGGAGGTTCGGGAACTCCAGGAGCAGCTGGCCCGACAGCAGGTCCATGTGGAGCTTGACGTGGCCAAGCCAGACCTCACCGCAGCCCTGAAAGAGATCCGCACGCAGTATGAGGCAATGGCGTCCAGCAACATGCATGAAGCCGAAGAGTGGTACCGCTCCAAGTTTGCAGACCTGACAGACGCTGCTGCCCGCAACGCGGAGCTGCTCCGCCAGGCCAAGCACGAAGCCAACGACTACCGGCGCCAGTTGCAGTCCTTGACCTGCGACCTGGAGTCTCTGCGCGGCACGAACGAGTCCCTGGAGAGGCAGATGCGCGAGCAGGAGGAGCGGCACGTGCGGGAGGCGGCCAGTTATCAGGAGGCGCTGGCGCGGCTGGAGGAAGAGGGGCAGAGCCTCAAGGACGAGATGGCCCGCCACTTGCAGGAGTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGACATCGAGATCGCCACCTACAGGAAGCTGCTAGAGGGCGAGGAGAACCGGATCACCATTCCCGTGCAGACCTTCTCCAACCTGCAGATTCGAGAAACCAGCCTGGACACCAAGTCTGTGTCAGAAGGCCACCTCAAGAGGAACATCGTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGA

Back to List