Details for gene: MBP


The action of a molecule that contributes to the structural integrity of the myelin sheath of a nerve.


Symbol
MBP
Name
myelin basic protein
Entrez ID
4155
Ensembl ID
ENSG00000197971    (more details)
KEGG ID
hsa:4155    (more details)
OMIM ID
159430
Uniprot ID
P02686  
GO ID
hsa:4155    (more details)
Chromosome
18
Strand
-1
Start
76978827
End
77133683
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-455-5p (RPM: 19.0882) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-3130-5p (RPM: 0.302) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-219a-5p (RPM: 0.9656) / hsa-miR-4742-3p (RPM: 0.5414) / hsa-miR-378g (RPM: 0.7666) / hsa-miR-200a-5p (RPM: 14.0094) / hsa-miR-4999-5p (RPM: 0.394) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-502-3p (RPM: 26.4154) / hsa-miR-501-3p (RPM: 166.2736) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-200c-5p (RPM: 0.9464) /
Involved Diseases
neuromyelitis optica (NMO) /
Involved Pathways
EGR2 and SOX10-mediated initiation of Schwann cell myelination /
Sequence
ATGGGAAACCACGCAGGCAAACGAGAATTAAATGCCGAGAAGGCCAGTACGAATAGTGAAACTAACAGAGGAGAATCTGAAAAAAAGAGAAACCTGGGTGAACTTTCACGGACAACCTCAGAGGACAACGAAGTGTTCGGAGAGGCAGATGCGAACCAGAACAATGGGACCTCCTCTCAGGACACAGCGGTGACTGACTCCAAGCGCACAGCGGACCCGAAGAATGCCTGGCAGGATGCCCACCCAGCTGACCCAGGGAGCCGCCCCCACTTGATCCGCCTCTTTTCCCGAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTCTGAGTCCGACGAGCTCCAGACCATCCAAGAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGACTCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGGGAAAGGGGAGAGGACTGTCCCTGAGCAGATTTAGCTGGGGGGCCGAAGGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTGGATCACCCATGGCTAGACGCTGA

Back to List