Details for gene: IFNA2


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
IFNA2
Name
interferon alpha 2
Entrez ID
3440
Ensembl ID
ENSG00000188379    (more details)
KEGG ID
hsa:3440    (more details)
OMIM ID
147562
Uniprot ID
P01563  
GO ID
hsa:3440    (more details)
Chromosome
9
Strand
-1
Start
21384255
End
21385398
miRNA Interactions
hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-941 (RPM: 399.631) /
Involved Diseases
uveal melanoma / pterygium / Vogt-Koyanagi-Harada disease /
Involved Pathways
PI3K-Akt signaling pathway / Epstein-Barr virus infection / Pathways in cancer / RIG-I-like receptor signaling pathway / Cytokine-cytokine receptor interaction / Jak-STAT signaling pathway / Natural killer cell mediated cytotoxicity / Tuberculosis / Hepatitis C / Hepatitis B / Measles / Influenza A / Herpes simplex infection / Toll-like receptor signaling pathway / NOD-like receptor signaling pathway / Cytosolic DNA-sensing pathway / Autoimmune thyroid disease / Cytokine Signaling in Immune system / Immune System / Hemostasis / Innate Immune System / DDX58/IFIH1-mediated induction of interferon-alpha/beta / Interferon Signaling / TRAF6 mediated IRF7 activation / Factors involved in megakaryocyte development and platelet production / Interferon alpha/beta signaling / Regulation of IFNA signaling / Lipid and atherosclerosis / Necroptosis / Alcoholic liver disease / Human cytomegalovirus infection / Human papillomavirus infection / Kaposi sarcoma-associated herpesvirus infection / Human immunodeficiency virus 1 infection / Coronavirus disease - COVID-19 /
Sequence
ATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATGA

Back to List