Details for gene: CDKN2A


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
CDKN2A
Name
cyclin dependent kinase inhibitor 2A
Entrez ID
1029
Ensembl ID
ENSG00000147889    (more details)
KEGG ID
hsa:1029    (more details)
OMIM ID
600160
Uniprot ID
P42771  
GO ID
hsa:1029    (more details)
Chromosome
9
Strand
-1
Start
21967752
End
21995301
miRNA Interactions
hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-1291 (RPM: 2.2386) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-3943 (RPM: 0.8342) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-181b-3p (RPM: 2.493) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-215-5p (RPM: 12.4448) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-296-3p (RPM: 8.5012) / hsa-miR-24-2-5p (RPM: 18.574) / hsa-miR-1537-3p (RPM: 0.1306) / hsa-miR-24-1-5p (RPM: 3.1364) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-423-3p (RPM: 1928.5158) /
Involved Diseases
uveal melanoma / retinoblastoma / glaucoma /
Involved Pathways
MicroRNAs in cancer / Cell cycle / p53 signaling pathway / HTLV-I infection / Pathways in cancer / Pancreatic cancer / Bladder cancer / Viral carcinogenesis / Chronic myeloid leukemia / Glioma / Melanoma / Non-small cell lung cancer / Cellular responses to stress / Cellular responses to external stimuli / Generic Transcription Pathway / RNA Polymerase II Transcription / Gene expression (Transcription) / Apoptosis / Programmed Cell Death / Cell Cycle / Disease / Cell Cycle, Mitotic / Metabolism of proteins / Post-translational protein modification / Cellular Senescence / Transcriptional Regulation by TP53 / Regulation of TP53 Activity / Regulation of TP53 Degradation / Regulation of TP53 Expression and Degradation / Stabilization of p53 / p53-Dependent G1 DNA Damage Response / p53-Dependent G1/S DNA damage checkpoint / G1/S DNA Damage Checkpoints / Cell Cycle Checkpoints / Intrinsic Pathway for Apoptosis / Apoptotic factor-mediated response / Oxidative Stress Induced Senescence / Senescence-Associated Secretory Phenotype (SASP) / Oncogene Induced Senescence / Mitotic G1 phase and G1/S transition / Cyclin D associated events in G1 / G1 Phase / Diseases of Cellular Senescence / Evasion of Oncogene Induced Senescence Due to p16INK4A Defects / Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 / Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 / Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects / Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 / Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 / Diseases of cellular response to stress / SUMOylation / SUMO E3 ligases SUMOylate target proteins / SUMOylation of transcription factors / SUMOylation of DNA damage response and repair proteins / Transcriptional Regulation by VENTX / Transcriptional regulation by RUNX3 / Regulation of RUNX3 expression and activity / Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function / Diseases of programmed cell death / Evasion of Oncogene Induced Senescence Due to p14ARF Defects / Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects / Cushing syndrome / Platinum drug resistance / Human cytomegalovirus infection / Cellular senescence / Hepatocellular carcinoma / Endocrine resistance /
Sequence
ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATCCAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGACATCCCCGATTGA

Back to List