Details for gene: MYLK


This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts.


Symbol
MYLK
Name
myosin light chain kinase
Entrez ID
4638
Ensembl ID
ENSG00000065534    (more details)
KEGG ID
hsa:4638    (more details)
OMIM ID
600922
Uniprot ID
Q15746  
GO ID
hsa:4638    (more details)
Chromosome
3
Strand
-1
Start
123610049
End
123884332
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-4684-3p (RPM: 0.2602) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-603 (RPM: 0.0052) / hsa-miR-520c-3p (RPM: 0.0046) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-589-5p (RPM: 54.2348) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-365b-3p (RPM: 22.318) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-539-5p (RPM: 2.3354) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-136-3p (RPM: 178.2682) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-1272 (RPM: 0.015) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-3682-3p (RPM: 0.0134) / hsa-miR-5581-3p (RPM: 0.3204) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-376c-3p (RPM: 10.6544) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-28-5p (RPM: 190.0872) / hsa-miR-5094 (RPM: 0.1872) / hsa-miR-5190 (RPM: 0.0244) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-4717-3p (RPM: 0.2604) / hsa-miR-4691-3p (RPM: 0.0364) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-4328 (RPM: 0.0008) / hsa-miR-490-5p (RPM: 0.869) / hsa-miR-941 (RPM: 399.631) / hsa-miR-513b-3p (RPM: 0.1202) / hsa-miR-7156-3p (RPM: 0.0008) /
Involved Diseases
glaucoma /
Involved Pathways
Calcium signaling pathway / cGMP-PKG signaling pathway / Focal adhesion / Vascular smooth muscle contraction / Regulation of actin cytoskeleton / Oxytocin signaling pathway / Platelet activation / Gastric acid secretion / RHO GTPases activate PAKs / Smooth Muscle Contraction / Apelin signaling pathway /
Sequence
ATGGGGGATGTGAAGCTGGTTGCCTCGTCACACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACAGAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCCAAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGGCAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGCCTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAATGGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAGCTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAGACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTTGTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCGCAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCTGAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTGTACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATCCAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGATGTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCTGCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCAAACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGAACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCAAGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAGAGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGGAGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGATTCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACTGTCAAGTTCAGATGTGAAGTTTCCGGGATTCCAAAGCCTGAAGTGGCCTGGTTCCTGGAAGGCACCCCCGTGAGGAGACAGGAAGGCAGCATTGAGGTTTATGAAGATGCTGGCTCCCATTACCTCTGCCTGCTGAAAGCCCGGACCAGGGACAGTGGGACATACAGCTGCACTGCTTCCAACGCCCAAGGCCAGCTGTCCTGTAGCTGGACCCTCCAAGTGGAAAGGCTTGCCGTGATGGAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGATTTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAATGGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATCCAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGGCAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAGTACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCTGATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCACCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCACTTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACGGGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTCACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTGACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCTACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTGCTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGCCAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATGCTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGACCTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGGCCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGAGGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAGGAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTATCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAGCGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAGGTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAGGTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAATTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGTTCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAGCCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGACGTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGATCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCAGAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATCTGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGCTCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGTGTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCTCCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTTCCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACACCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGCGCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACCTGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTATGGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAGCCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGGACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTAGGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGGGCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATTAGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAAAAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATCATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCGGAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAACATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGGAGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCTGAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATCTGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTGGCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGACGATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGCACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAACTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAATGCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAAGATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTATTTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGCAAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGGGAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGTGATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAAGCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAAGAGGAAGAAGAGTGA

Back to List