Details for gene: CPAMD8


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
CPAMD8
Name
C3 and PZP like alpha-2-macroglobulin domain containing 8
Entrez ID
27151
Ensembl ID
ENSG00000160111    (more details)
KEGG ID
hsa:27151    (more details)
OMIM ID
608841
Uniprot ID
Q8IZJ3  
GO ID
hsa:27151    (more details)
Chromosome
19
Strand
-1
Start
16892951
End
17026815
miRNA Interactions
hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-218-5p (RPM: 36.775) /
Involved Diseases
cataract / glaucoma /
Involved Pathways
Sequence
ATGAGCGGCGCCCTGCTCTGGCCGTTGCTCCCGCTCCTGCTCCTGCTGCTGTCGGCGCGGGACGGCGTGCGCGCCGCGCAGCCTCAGGCCCCGGGTTACTTGATTGCAGCTCCCTCTGTTTTTCGCGCGGGCGTGGAGGAAGTCATCAGCGTGACCATCTTTAACTCTCCAAGGGAAGTCACGGTCCAGGCTCAGCTGGTGGCCCAGGGTGAGCCGGTGGTGCAGAGCCAGGGAGCCATCCTGGATAAAGGGACAATCAAACTCAAGGTGCCCACGGGCCTCCGGGGCCAAGCGCTTCTGAAAGTGTGGGGCCGCGGCTGGCAGGCGGAGGAGGGGCCCCTCTTTCACAACCAGACCTCGGTGACCGTGGACGGCCGGGGCGCTTCTGTATTCATCCAGACGGACAAGCCTGTGTACAGACCCCAGCACCGAGTGCTCATAAGCATCTTCACCGTCTCTCCAAATCTGAGGCCTGTCAACGAGAAGCTGGAAGCCTACATCCTGGACCCCCGAGGCTCTCGGATGATAGAGTGGAGACACTTAAAGCCGTTCTGCTGCGGCATCACCAACATGAGCTTCCCCTTGTCCGACCAGCCTGTGTTGGGAGAATGGTTCATTTTTGTTGAAATGCAAGGCCACGCGTACAACAAGTCTTTTGAAGTTCAGAAGTATGTGTTGCCCAAGTTTGAGCTTCTGATTGACCCGCCCCGGTATATCCAAGACCTGGACGCCTGTGAGACAGGCACTGTGCGGGCCAGGTATACCTTTGGGAAACCTGTGGCTGGTGCCTTAATGATCAACATGACTGTTAATGGTGTAGGGTACTACAGCCACGAGGTGGGACGCCCTGTCCTCAGAACAACCAAGATCCTCGGCTCCCGGGACTTCGACATCTGCGTGAGGGACATGATCCCAGCGGACGTCCCTGAGCACTTCCGGGGCAGGGTCAGCATCTGGGCCATGGTGACCAGTGTGGACGGGAGCCAGCAGGTCGCGTTCGATGACTCCACCCCCGTGCAGAGGCAGCTGGTGGACATCCGGTACTCCAAGGACACGAGGAAGCAGTTCAAGCCGGGCCTGGCCTACGTGGGGAAGGTGGAGCTATCCTACCCCGATGGCAGCCCAGCTGAGGGGGTGACGGTCCAGATTAAGGCAGAGCTGACACCAAAGGATAACATCTACACCAGTGAAGTTGTGTCCCAGCGTGGACTAGTGGGGTTTGAAATCCCCTCCATCCCCACGTCAGCCCAGCACGTGTGGCTGGAGACCAAGGTGATGGCACTGAACGGGAAGCCTGTGGGGGCTCAGTACCTGCCCAGCTACCTCTCCCTCGGCAGCTGGTACTCCCCCAGCCAGTGCTACCTGCAGCTGCAGCCACCCTCCCACCCACTGCAGGTTGGGGAAGAAGCCTATTTTTCTGTGAAGTCCACATGTCCCTGCAACTTTACCCTGTACTACGAGGTGGCTGCACGGGGCAATATTGTGCTATCGGGCCAGCAGCCTGCCCACACCACCCAGCAGCGAAGCAAGCGGGCGGCCCCTGCCCTGGAGAAACCGATTCGTTTAACACACCTTTCTGAGACAGAGCCCCCACCAGCCCCAGAAGCTGAGGTCGACGTGTGTGTGACCTCTCTTCATCTGGCCGTGACCCCCAGCATGGTCCCCCTTGGTCGCCTGCTGGTCTTCTACGTCAGGGAGAATGGAGAAGGGGTCGCCGACAGCCTTCAGTTTGCAGTCGAGACCTTCTTCGAAAACCAGGTTTCAGTGACGTATTCAGCAAATGAGACCCAACCTGGGGAGGTTGTCGACCTGCGGATCAGGGCTGCAAGGGGCAGCTGTGTGTGCGTCGCCGCAGTTGATAAGAGTGTCTACCTGCTCAGGTCTGGGTTCCGGCTGACTCCTGCCCAGGTTTTCCAGGAACTGGAAGATTATGATGTTTCTGATTCCTTTGGCGTGTCCAGGGAGGATGGTCCTTTTTGGTGGGCTGGGCTGACGGCACAACGACGCCGGCGCTCCTCTGTCTTCCCGTGGCCTTGGGGCATCACCAAGGACTCTGGGTTTGCCTTCACCGAAACGGGACTGGTGGTGATGACCGACCGAGTGAGCCTGAACCACCGGCAGGACGGTGGCCTCTACACCGATGAGGCTGTCCCCGCTTTCCAGCCCCACACAGGGAGCCTGGTGGCAGTGGCTCCTTCCAGGCACCCCCCCAGAACAGAGAAGAGAAAAAGGACTTTCTTCCCCGAAACATGGATTTGGCATTGTCTCAACATCAGTGACCCATCTGGTGAGGGGACACTCAGTGTGAAGGTCCCGGACTCCATCACCAGCTGGGTGGGTGAGGCCGTGGCCCTGTCCACCTCTCAGGGCTTAGGCATCGCCGAGCCCTCCCTGCTGAAGACCTTCAAGCCCTTCTTCGTGGACTTCATGCTCCCCGCTCTCATCATCCGTGGGGAGCAGGTCAAGATCCCGCTCAGTGTCTACAACTACATGGGCACCTGCGCTGAGGTGTACATGAAGCTCTCGGTTCCCAAGGGCATCCAGTTTGTTGGGCATCCTGGCAAACGCCATGTGACCAAGAAGATGTGTGTGGCCCCCGGGGAGGCTGAGCCCATCTGGGTCGTTCTGTCCTTCAGCGACCTGGGACTCAACAACATCACGGCCAAAGCCCTTGCTTACGGAGACACAAATTGCTGCCGGGATGGGAGGTCCAGCAAACACCCTGAGGAGAATCACGCCGACAGGAGGGTCCCCATCGGGGTGGATCACGTCAGGCGCAGTGTGATGGTTGAGGCGGAAGGAGTCCCCCGGGCGTACACCTACAGCGCATTCTTCTGTCCCAGTGAGAGAGTCCACATCTCCACCCCCAACAAGTATGAGTTCCAGTATGTGCAGCGGCCACTGCGCCTCACCCGCTTTGATGTGGCTGTGCGAGCTCACAATGATGCCCGTGTGGCCTTGTCTTCTGGGCCCCAGGACACAGCAGGCATGATCGAGATCGTCCTGGGGGGGCATCAGAACACCAGGTCATGGATCTCCACCAGCAAGATGGGAGAGCCCGTGGCCAGTGCACACACGGCCAAGATCCTCTCCTGGGATGAATTCAGAACATTCTGGATCAGCTGGCGTGGTGGCCTTATCCAGGTTGGCCATGGTCCAGAGCCATCCAATGAGTCTGTCATTGTGGCCTGGACCCTCCCGAGGCCACCAGAGGTCCAGTTCATTGGCTTTTCCACCGGCTGGGGCTCCATGGGTGAATTCCGAATCTGGAGGAAGATGGAGGTGGACGAGAGCTACAGCGAGGCCTTCACCCTGGGGGTCCCACACGGCGCCATCCCTGGGTCTGAGCGAGCCACCGCCTCCATCATCGGGGACGTCATGGGGCCAACCCTGAACCACCTCAACAACCTCCTGCGGCTGCCGTTTGGCTGTGGAGAGCAGAACATGATCCACTTTGCACCCAACGTCTTTGTCTTGAAGTATCTTCAGAAAACCCAGCAGCTCAGCCCTGAGGTGGAGAGAGAGACCACCGACTACCTAGTACAAGGCTACCAGCGCCAGCTGACCTACAAGCGCCAGGATGGCTCCTACAGCGCGTTTGGGGAGCGGGACGCATCGGGGAGCATGTGGCTCACAGCCTTTGTCCTGAAGTCCTTCGCACAGGCTCGCAGCTTTATCTTCGTGGACCCCCGGGAGCTGGCTGCCGCCAAGAGCTGGATCATCCAGCAGCAGCAGGCCGATGGCTCCTTCCTGGCCGTGGGCAGGGTCCTGAACAAGGACATCCAGGGTGGGATCCACGGCACTGTCCCGCTGACAGCCTACGTGGTGGTTGCTCTCCTGGAAACAGGCACAGCCTCAGAGGAGGAGAGAGGCTCCACTGACAAAGCGAGGCACTTCCTGGAGTCTGCTGCGCCCCTGGCCATGGACCCTTATAGCTGTGCCCTGACTACCTACGCGCTGACCCTGCTCCGCAGCCCGGCAGCCCCTGAGGCACTGCGCAAGCTCCGTAGCCTGGCCATCATGCGAGATGGGGTCACCCACTGGAGCCTGTCAAATTCCTGGGACGTGGACAAGGGCACATTCTTGAGCTTCAGTGACAGGGTCTCTCAGTCAGTGGTCTCGGCCGAGGTGGAAATGACAGCCTACGCCCTTCTGACCTACACTCTGCTGGGTGACGTGGCTGCCGCCCTGCCTGTGGTGAAGTGGCTGTCCCAGCAGCGAAATGCACTTGGGGGCTTCTCCTCCACTCAGGACACCTGCGTGGCTCTGCAGGCCTTGGCTGAATATGCCATCTTGTCCTATGCTGGAGGCATCAACCTCACTGTCTCCCTGGCCTCCACCAACCTGGACTACCAGGAAACCTTCGAGCTGCACAGGACCAACCAGAAGGTTCTGCAGACAGCAGCGATCCCCAGCCTCCCCACGGGGCTGTTTGTGAGTGCCAAGGGGGACGGCTGCTGCCTGATGCAGATTGATGTCACCTACAATGTGCCTGACCCGGTGGCCAAGCCAGCTTTCCAGCTGCTCGTAAGCCTCCAGGAGCCTGAGGCCCAGGGACGCCCGCCCCCCATGCCTGCCTCCGCAGCTGAGGGTTCCCGAGGAGACTGGCCCCCAGCTGACGATGATGACCCAGCGGCCGATCAGCATCACCAGGAATACAAGGTGATGCTGGAGGTGTGCACCAGGTGGCTGCATGCAGGGTCTTCCAATATGGCTGTCCTGGAGGTGCCCCTGCTGTCAGGCTTCCGGGCAGACATCGAGAGCCTGGAGCAGCTGCTCCTTGACAAGCACATGGGGATGAAGAGGTATGAAGTGGCTGGACGCCGAGTGCTCTTCTACTTTGATGAGATCCCCAGCCGGTGCCTGACGTGCGTGCGGTTCCGTGCTCTCCGGGAGTGCGTGGTGGGCAGGACGTCGGCGCTGCCAGTCTCCGTGTACGACTACTACGAACCCGCCTTCGAGGCCACTCGCTTCTACAACGTCAGCACCCACAGCCCACTCGCCCGGGAACTGTGCGCCGGACCCGCGTGCAACGAAGTGGAGCGCGCCCCTGCCCGGGGCCCGGGCTGGTTCCCCGGCGAGTCGGGCCCTGCCGTGGCCCCTGAGGAGGGGGCGGCGATCGCGCGATGCGGCTGCGACCACGACTGCGGCGCCCAGGGGAACCCGGTGTGCGGCTCCGACGGGGTGGTCTACGCCAGCGCCTGCCGCCTGCGGGAGGCCGCCTGCCGCCAGGCCGCGCCCCTGGAGCCCGCGCCTCCCAGCTGCTGCGCCCTCGAGCAGCGGCTGCCGGCCTCGTCGTCCTCCACCTACGGGGATGACCTGGCTTCTGTGGCCCCGGGGCCTTTACAGCAGGACGTGAAGCTGAATGGAGCCGGCCTTGAGGTGGAGGACTCAGACCCTGAGCCTGAAGGGGAGGCGGAGGACAGGGTCACAGCCGGGCCTCGGCCTCCTGTGAGCAGCGGGAACCTGGAAAGCAGCACCCAGAGCGCCAGCCCGTTCCACAGATGGGGCCAGACTCCGGCCCCTCAGAGACATAGTGGCCGGGTGGTGGGGGCCCACAGGCCAGGGCTTCTGAGCCCTGTCTTCGTCTACAGCCCAGCCTTTCAGAGTGGTGGGGAGGAGGGTTTATGGATGTCAAACACCTGCACCTTGAGATAA

Back to List