Details for gene: OPA1


Interacting selectively and non-covalently with GTP, guanosine triphosphate.


Symbol
OPA1
Name
OPA1 mitochondrial dynamin like GTPase
Entrez ID
4976
Ensembl ID
ENSG00000198836    (more details)
KEGG ID
hsa:4976    (more details)
OMIM ID
605290
Uniprot ID
O60313  
GO ID
hsa:4976    (more details)
Chromosome
3
Strand
1
Start
193593144
End
193697811
miRNA Interactions
hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-3065-5p (RPM: 5.6206) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-103a-2-5p (RPM: 0.387) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-576-5p (RPM: 10.7352) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-505-3p (RPM: 14.5424) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-215-5p (RPM: 12.4448) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-629-5p (RPM: 7.1172) / hsa-miR-585-3p (RPM: 1.7452) / hsa-miR-1255a (RPM: 0.3384) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) / hsa-let-7d-3p (RPM: 228.047) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Apoptosis / Programmed Cell Death / Regulation of Apoptosis / Spinocerebellar ataxia /
Sequence
ATGTGGCGACTACGTCGGGCCGCTGTGGCCTGTGAGGTCTGCCAGTCTTTAGTGAAACACAGCTCTGGAATAAAAGGAAGTTTACCACTACAAAAACTACATCTGGTTTCACGAAGCATTTATCATTCACATCATCCTACCTTAAAGCTTCAACGACCCCAATTAAGGACATCCTTTCAGCAGTTCTCTTCTCTGACAAACCTTCCTTTACGTAAACTGAAATTCTCTCCAATTAAATATGGCTACCAGCCTCGCAGGAATTTTTGGCCAGCAAGATTAGCTACGAGACTCTTAAAACTTCGCTATCTCATACTAGGATCGGCTGTTGGGGGTGGCTACACAGCCAAAAAGACTTTTGATCAGTGGAAAGATATGATACCGGACCTTAGTGAATATAAATGGATTGTGCCTGACATTGTGTGGGAAATTGATGAGTATATCGATTTTGAGAAAATTAGAAAAGCCCTTCCTAGTTCAGAAGACCTTGTAAAGTTAGCACCAGACTTTGACAAGATTGTTGAAAGCCTTAGCTTATTGAAGGACTTTTTTACCTCAGGTTCTCCGGAAGAAACGGCGTTTAGAGCAACAGATCGTGGATCTGAAAGTGACAAGCATTTTAGAAAGGTGTCAGACAAAGAGAAAATTGACCAACTTCAGGAAGAACTTCTGCACACTCAGTTGAAGTATCAGAGAATCTTGGAACGATTAGAAAAGGAGAACAAAGAATTGAGAAAATTAGTATTGCAGAAAGATGACAAAGGCATTCATCATAGAAAGCTTAAGAAATCTTTGATTGACATGTATTCTGAAGTTCTTGATGTTCTCTCTGATTATGATGCCAGTTATAATACGCAAGATCATCTGCCACGGGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAGGTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCTCGGGAGTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATTAAGACATGAAATAGAACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGTACCGTTAGCCCTGAGACCATATCCTTAAATGTAAAAGGCCCTGGACTACAGAGGATGGTGCTTGTTGACTTACCAGGTGTGATTAATACTGTGACATCAGGCATGGCTCCTGACACAAAGGAAACTATTTTCAGTATCAGCAAAGCTTACATGCAGAATCCTAATGCCATCATACTGTGTATTCAAGATGGATCTGTGGATGCTGAACGCAGTATTGTTACAGACTTGGTCAGTCAAATGGACCCTCATGGAAGGAGAACCATATTCGTTTTGACCAAAGTAGACCTGGCAGAGAAAAATGTAGCCAGTCCAAGCAGGATTCAGCAGATAATTGAAGGAAAGCTCTTCCCAATGAAAGCTTTAGGTTATTTTGCTGTTGTAACAGGAAAAGGGAACAGCTCTGAAAGCATTGAAGCTATAAGAGAATATGAAGAAGAGTTTTTTCAGAATTCAAAGCTCCTAAAGACAAGCATGCTAAAGGCACACCAAGTGACTACAAGAAATTTAAGCCTTGCAGTATCAGACTGCTTTTGGAAAATGGTACGAGAGTCTGTTGAACAACAGGCTGATAGTTTCAAAGCAACACGTTTTAACCTTGAAACTGAATGGAAGAATAACTATCCTCGCCTGCGGGAACTTGACCGGAATGAACTATTTGAAAAAGCTAAAAATGAAATCCTTGATGAAGTTATCAGTCTGAGCCAGGTTACACCAAAACATTGGGAGGAAATCCTTCAACAATCTTTGTGGGAAAGAGTATCAACTCATGTGATTGAAAACATCTACCTTCCAGCTGCGCAGACCATGAATTCAGGAACTTTTAACACCACAGTGGATATCAAGCTTAAACAGTGGACTGATAAACAACTTCCTAATAAAGCAGTAGAGGTTGCTTGGGAGACCCTACAAGAAGAATTTTCCCGCTTTATGACAGAACCGAAAGGGAAAGAGCATGATGACATATTTGATAAACTTAAAGAGGCTGTTAAGGAAGAAAGTATTAAACGACACAAGTGGAATGACTTTGCGGAGGACAGCTTGAGGGTTATTCAACACAATGCTTTGGAAGACCGATCCATATCTGATAAACAGCAATGGGATGCAGCTATTTATTTTATGGAAGAGGCTCTGCAGGCTCGTCTCAAGGATACTGAAAATGCAATTGAAAACATGGTGGGTCCAGACTGGAAAAAGAGGTGGTTATACTGGAAGAATCGGACCCAAGAACAGTGTGTTCACAATGAAACCAAGAATGAATTGGAGAAGATGTTGAAATGTAATGAGGAGCACCCAGCTTATCTTGCAAGTGATGAAATAACCACAGTCCGGAAGAACCTTGAATCCCGAGGAGTAGAAGTAGATCCAAGCTTGATTAAGGATACTTGGCATCAAGTTTATAGAAGACATTTTTTAAAAACAGCTCTAAACCATTGTAACCTTTGTCGAAGAGGTTTTTATTACTACCAAAGGCATTTTGTAGATTCTGAGTTGGAATGCAATGATGTGGTCTTGTTTTGGCGTATACAGCGCATGCTTGCTATCACCGCAAATACTTTAAGGCAACAACTTACAAATACTGAAGTTAGGCGATTAGAGAAAAATGTTAAAGAGGTATTGGAAGATTTTGCTGAAGATGGTGAGAAGAAGATTAAATTGCTTACTGGTAAACGCGTTCAACTGGCGGAAGACCTCAAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAA

Back to List